VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for E3L are 4
Results from 0 - 25

siRNA sequence "aauaucgucggagcuguacac" alignment with "Vaccinia" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Vaccinia" virus
Browse "virsi1408 " record
Length: 21
GC Content:48 %
GenBank Acc: NC_001611
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aauaucgucggagcuguacac" siRNA in Human Genome sequences
See NC_001611 at Genbank
Pubmed:16480752
Article:siRNA targeting vaccinia virus double-stranded RNA binding protein [E3L] exerts potent antiviral effects.
Authors:Dave RS, McGettigan JP, Qureshi T, Schnell MJ, Nunnari G, Pomerantz RJ.
Journal:Virology. 2006 May 10;348(2):489-97. Epub 2006 Feb 9.
Entrez:16480752

siRNA sequence "aauacucucccgucgaugucu" alignment with "Vaccinia" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Vaccinia" virus
Browse "virsi1410 " record
Length: 21
GC Content:48 %
GenBank Acc: NC_001611
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aauacucucccgucgaugucu" siRNA in Human Genome sequences
See NC_001611 at Genbank
Pubmed:16480752
Article:siRNA targeting vaccinia virus double-stranded RNA binding protein [E3L] exerts potent antiviral effects.
Authors:Dave RS, McGettigan JP, Qureshi T, Schnell MJ, Nunnari G, Pomerantz RJ.
Journal:Virology. 2006 May 10;348(2):489-97. Epub 2006 Feb 9.
Entrez:16480752

siRNA sequence "aagacuuaugauccucucuca" alignment with "Vaccinia" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Vaccinia" virus
Browse "virsi1411 " record
Length: 21
GC Content:38 %
GenBank Acc: NC_001611
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aagacuuaugauccucucuca" siRNA in Human Genome sequences
See NC_001611 at Genbank
Pubmed:16480752
Article:siRNA targeting vaccinia virus double-stranded RNA binding protein [E3L] exerts potent antiviral effects.
Authors:Dave RS, McGettigan JP, Qureshi T, Schnell MJ, Nunnari G, Pomerantz RJ.
Journal:Virology. 2006 May 10;348(2):489-97. Epub 2006 Feb 9.
Entrez:16480752

siRNA sequence "aacgcucgucaauauagaucu" alignment with "Vaccinia" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Vaccinia" virus
Browse "virsi1409 " record
Length: 21
GC Content:38 %
GenBank Acc: NC_001611
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aacgcucgucaauauagaucu" siRNA in Human Genome sequences
See NC_001611 at Genbank
Pubmed:16480752
Article:siRNA targeting vaccinia virus double-stranded RNA binding protein [E3L] exerts potent antiviral effects.
Authors:Dave RS, McGettigan JP, Qureshi T, Schnell MJ, Nunnari G, Pomerantz RJ.
Journal:Virology. 2006 May 10;348(2):489-97. Epub 2006 Feb 9.
Entrez:16480752


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1408	aauaucgucggagcuguacac	Vaccinia	E3L	HeLa	Protein	97	16480752	Blast SL	refseqs
virsi1410	aauacucucccgucgaugucu	Vaccinia	E3L	HeLa	Protein	83	16480752	Blast SL	refseqs
virsi1411	aagacuuaugauccucucuca	Vaccinia	E3L	HeLa	Protein	36	16480752	Blast SL	refseqs
virsi1409	aacgcucgucaauauagaucu	Vaccinia	E3L	HeLa	Protein	0	16480752	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm