VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for VP1 are 10
Results from 0 - 25

siRNA sequence "cacaccaaauuauguaugu" alignment with "Human Coxsackievirus [CV]" virus reference Genome sequences
siRNA sequence matching with "cacaccaaauuauguaugu" Human Coxsackievirus [CV]" Virus reference Genome sequences
Browse all the records for "Human Coxsackievirus [CV]" virus
Browse "virsi2160 " record
Length: 19
GC Content:32 %
Strain of Virus: B3
GenBank Acc: U57056
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "cacaccaaauuauguaugu" siRNA in Human Genome sequences
See U57056 at Genbank
Pubmed:17222937
Article:Expression of short hairpin RNAs against the coxsackievirus B3 exerts potential antiviral effects in Cos-7 cells and in mice.
Authors:Kim JY, Chung SK, Hwang HY, Kim H, Kim JH, Nam JH, Park SI.
Journal:Virus Res. 2007 Apr;125(1):9-13. Epub 2007 Jan 12.
Entrez:17222937

siRNA sequence "gaacuaccauucaaggucu" alignment with "Human Coxsackievirus [CV]" virus reference Genome sequences
siRNA sequence matching with "gaacuaccauucaaggucu" Human Coxsackievirus [CV]" Virus reference Genome sequences
Browse all the records for "Human Coxsackievirus [CV]" virus
Browse "virsi2159 " record
Length: 19
GC Content:42 %
Strain of Virus: B3
GenBank Acc: U57056
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "gaacuaccauucaaggucu" siRNA in Human Genome sequences
See U57056 at Genbank
Pubmed:17222937
Article:Expression of short hairpin RNAs against the coxsackievirus B3 exerts potential antiviral effects in Cos-7 cells and in mice.
Authors:Kim JY, Chung SK, Hwang HY, Kim H, Kim JH, Nam JH, Park SI.
Journal:Virus Res. 2007 Apr;125(1):9-13. Epub 2007 Jan 12.
Entrez:17222937

siRNA sequence "uccagcacuccaagcugcugaaauu" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "uccagcacuccaagcugcugaaauu" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1777 " record
Length: 25
GC Content:48 %
Starting position: 2570
Strain of Virus: EV71 Strain Shzh-98
GenBank Acc: AF302996
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "uccagcacuccaagcugcugaaauu" siRNA in Human Genome sequences
See AF302996 at Genbank
Pubmed:19490979
Article:Identification of small interfering RNAs which inhibit the replication of several Enterovirus 71 strains in China.
Authors:Wu Z, Yang F, Zhao R, Zhao L, Guo D, Jin Q.
Journal:J Virol Methods. 2009 Aug;159(2):233-8. Epub 2009 Apr 10.
Entrez:19490979

siRNA sequence "gcaugucaaagcguggaua" alignment with "Human Coxsackievirus [CV]" virus reference Genome sequences
siRNA sequence matching with "gcaugucaaagcguggaua" Human Coxsackievirus [CV]" Virus reference Genome sequences
Browse all the records for "Human Coxsackievirus [CV]" virus
Browse "virsi1789 " record
Length: 19
GC Content:47 %
Starting position: 3171
Strain of Virus: CVB3
GenBank Acc: M33854
Transfection Reagent: Oligofectamine

Offtargets for "gcaugucaaagcguggaua" siRNA in Human Genome sequences
See M33854 at Genbank
Pubmed:15681418
Article:Inhibition of coxsackievirus B3 replication by small interfering RNAs requires perfect sequence match in the central region of the viral positive strand.
Authors:Yuan J, Cheung PK, Zhang HM, Chau D, Yang D.
Journal:J Virol. 2005 Feb;79(4):2151-9.
Entrez:15681418

siRNA sequence "caugucaccugcgagugcuuaucaa" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "caugucaccugcgagugcuuaucaa" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1778 " record
Length: 25
GC Content:48 %
Starting position: 3020
Strain of Virus: EV71 Strain Shzh-98
GenBank Acc: AF302996
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caugucaccugcgagugcuuaucaa" siRNA in Human Genome sequences
See AF302996 at Genbank
Pubmed:19490979
Article:Identification of small interfering RNAs which inhibit the replication of several Enterovirus 71 strains in China.
Authors:Wu Z, Yang F, Zhao R, Zhao L, Guo D, Jin Q.
Journal:J Virol Methods. 2009 Aug;159(2):233-8. Epub 2009 Apr 10.
Entrez:19490979

siRNA sequence "aucggagcuucgucgaaug" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "aucggagcuucgucgaaug" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1771 " record
Length: 19
GC Content:53 %
Starting position: 2592
Strain of Virus: EV71
GenBank Acc: U22521
Transfection Reagent: Geneporter

Offtargets for "aucggagcuucgucgaaug" siRNA in Human Genome sequences
See U22521 at Genbank
Pubmed:15530419
Article:Selective inhibition of enterovirus 71 replication by short hairpin RNAs.
Authors:Lu WW, Hsu YY, Yang JY, Kung SH.
Journal:Biochem Biophys Res Commun. 2004 Dec 10;325(2):494-9.
Entrez:15530419

siRNA sequence "caggagcaccuauaccaac" alignment with "Human Rhinovirus" virus reference Genome sequences
siRNA sequence matching with "caggagcaccuauaccaac" Human Rhinovirus" Virus reference Genome sequences
Browse all the records for "Human Rhinovirus" virus
Browse "virsi2034 " record
Length: 19
GC Content:53 %
GenBank Acc: L24917
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "caggagcaccuauaccaac" siRNA in Human Genome sequences
See L24917 at Genbank
Pubmed:14670593
Article:Small interfering RNA molecules as potential anti-human rhinovirus agents: in vitro potency, specificity, and mechanism.
Authors:Phipps KM, Martinez A, Lu J, Heinz BA, Zhao G.
Journal:Antiviral Res. 2004 Jan;61(1):49-55.
Entrez:14670593

siRNA sequence "gcaucacuacaaugaca" alignment with "Human Coxsackievirus [CV]" virus reference Genome sequences
siRNA sequence matching with "gcaucacuacaaugaca" Human Coxsackievirus [CV]" Virus reference Genome sequences
Browse all the records for "Human Coxsackievirus [CV]" virus
Browse "virsi1799 " record
Length: 17
GC Content:41 %
Starting position: 3271
Strain of Virus: CVB3 Woodruff Strain
GenBank Acc: M33854
Transfection Reagent: Oligofectamine
Incubation Time (Hours):12

Offtargets for "gcaucacuacaaugaca" siRNA in Human Genome sequences
See M33854 at Genbank
Pubmed:15956603
Article:A small interfering RNA targeting coxsackievirus B3 protects permissive HeLa cells from viral challenge.
Authors:Ahn J, Jun ES, Lee HS, Yoon SY, Kim D, Joo CH, Kim YK, Lee H.
Journal:J Virol. 2005 Jul;79(13):8620-4.
Entrez:15956603

siRNA sequence "aagcaccauuagaaucuac" alignment with "Human Coxsackievirus [CV]" virus reference Genome sequences
siRNA sequence matching with "aagcaccauuagaaucuac" Human Coxsackievirus [CV]" Virus reference Genome sequences
Browse all the records for "Human Coxsackievirus [CV]" virus
Browse "virsi1798 " record
Length: 19
GC Content:37 %
Starting position: 3143
Strain of Virus: CVB3 Woodruff Strain
GenBank Acc: M33854
Transfection Reagent: Oligofectamine
Incubation Time (Hours):12

Offtargets for "aagcaccauuagaaucuac" siRNA in Human Genome sequences
See M33854 at Genbank
Pubmed:15956603
Article:A small interfering RNA targeting coxsackievirus B3 protects permissive HeLa cells from viral challenge.
Authors:Ahn J, Jun ES, Lee HS, Yoon SY, Kim D, Joo CH, Kim YK, Lee H.
Journal:J Virol. 2005 Jul;79(13):8620-4.
Entrez:15956603

siRNA sequence "uaccacaucaaaugcagcc" alignment with "Human Rhinovirus" virus reference Genome sequences
siRNA sequence matching with "uaccacaucaaaugcagcc" Human Rhinovirus" Virus reference Genome sequences
Browse all the records for "Human Rhinovirus" virus
Browse "virsi2033 " record
Length: 19
GC Content:47 %
GenBank Acc: L24917
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "uaccacaucaaaugcagcc" siRNA in Human Genome sequences
See L24917 at Genbank
Pubmed:14670593
Article:Small interfering RNA molecules as potential anti-human rhinovirus agents: in vitro potency, specificity, and mechanism.
Authors:Phipps KM, Martinez A, Lu J, Heinz BA, Zhao G.
Journal:Antiviral Res. 2004 Jan;61(1):49-55.
Entrez:14670593


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi2160	cacaccaaauuauguaugu	Human Coxsackievirus [CV]	VP1	COS-7	mRNA	Low	17222937	Blast SL	refseqs
virsi2159	gaacuaccauucaaggucu	Human Coxsackievirus [CV]	VP1	COS-7	mRNA	High	17222937	Blast SL	refseqs
virsi1777	uccagcacuccaagcugcugaaauu	Enterovirus [EV]	VP1	RD	RNA	90	19490979	Blast SL	refseqs
virsi1789	gcaugucaaagcguggaua	Human Coxsackievirus [CV]	VP1	HeLa	Protein	85	15681418	Blast SL	refseqs
virsi1778	caugucaccugcgagugcuuaucaa	Enterovirus [EV]	VP1	RD	RNA	79	19490979	Blast SL	refseqs
virsi1771	aucggagcuucgucgaaug	Enterovirus [EV]	VP1	HeLa	Protein	78	15530419	Blast SL	refseqs
virsi2034	caggagcaccuauaccaac	Human Rhinovirus	VP1	HeLa	Plaque Count	77	14670593	Blast SL	refseqs
virsi1799	gcaucacuacaaugaca	Human Coxsackievirus [CV]	VP1	HeLa	Protein	46	15956603	Blast SL	refseqs
virsi1798	aagcaccauuagaaucuac	Human Coxsackievirus [CV]	VP1	HeLa	Protein	18	15956603	Blast SL	refseqs
virsi2033	uaccacaucaaaugcagcc	Human Rhinovirus	VP1	HeLa	Plaque Count	7	14670593	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm