Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for Human Respiratory Syncytial Virus [HRSV] are 9
Results from 0 - 25
siRNA sequence "gaugccaugauugguuuaa" alignment with "Human Respiratory Syncytial Virus [HRSV]" virus reference Genome sequences
siRNA sequence matching with "gaugccaugauugguuuaa" Human Respiratory Syncytial Virus [HRSV]" Virus reference Genome sequences
Browse all the records for "Human Respiratory Syncytial Virus [HRSV]" virus
Browse "virsi2019 " record
Length: 19
GC Content:37 %
Strain of Virus: Long Strain
GenBank Acc: AF035006
Length: 19
GC Content:37 %
Strain of Virus: Long Strain
GenBank Acc: AF035006
Offtargets for "gaugccaugauugguuuaa" siRNA in Human Genome sequences
See AF035006 at Genbank
Pubmed:15619632
Article:Inhibition of respiratory viruses by nasally administered siRNA.
Authors:Bitko V, Musiyenko A, Shulyayeva O, Barik S.
Journal:Nat Med. 2005 Jan;11(1):50-5. Epub 2004 Dec 26.
Entrez:15619632
Article:Inhibition of respiratory viruses by nasally administered siRNA.
Authors:Bitko V, Musiyenko A, Shulyayeva O, Barik S.
Journal:Nat Med. 2005 Jan;11(1):50-5. Epub 2004 Dec 26.
Entrez:15619632
siRNA sequence "ggcagcaauucauugaguaug" alignment with "Human Respiratory Syncytial Virus [HRSV]" virus reference Genome sequences
siRNA sequence matching with "ggcagcaauucauugaguaug" Human Respiratory Syncytial Virus [HRSV]" Virus reference Genome sequences
Browse all the records for "Human Respiratory Syncytial Virus [HRSV]" virus
Offtargets for "ggcagcaauucauugaguaug" siRNA in Human Genome sequences
See AF035006 at Genbank
Pubmed:17270047
Article:Respiratory syncytial virus infection in Fischer 344 rats is attenuated by short interfering RNA against the RSV-NS1 gene.
Authors:Kong X, Zhang W, Lockey RF, Auais A, Piedimonte G, Mohapatra SS.
Journal:Genet Vaccines Ther. 2007 Feb 1;5:4.
Entrez:17270047
Article:Respiratory syncytial virus infection in Fischer 344 rats is attenuated by short interfering RNA against the RSV-NS1 gene.
Authors:Kong X, Zhang W, Lockey RF, Auais A, Piedimonte G, Mohapatra SS.
Journal:Genet Vaccines Ther. 2007 Feb 1;5:4.
Entrez:17270047
siRNA sequence "ggcagcaauucauugaguaug" alignment with "Human Respiratory Syncytial Virus [HRSV]" virus reference Genome sequences
siRNA sequence matching with "ggcagcaauucauugaguaug" Human Respiratory Syncytial Virus [HRSV]" Virus reference Genome sequences
Browse all the records for "Human Respiratory Syncytial Virus [HRSV]" virus
Offtargets for "ggcagcaauucauugaguaug" siRNA in Human Genome sequences
See AF035006 at Genbank
Pubmed:17270047
Article:Respiratory syncytial virus infection in Fischer 344 rats is attenuated by short interfering RNA against the RSV-NS1 gene.
Authors:Kong X, Zhang W, Lockey RF, Auais A, Piedimonte G, Mohapatra SS.
Journal:Genet Vaccines Ther. 2007 Feb 1;5:4.
Entrez:17270047
Article:Respiratory syncytial virus infection in Fischer 344 rats is attenuated by short interfering RNA against the RSV-NS1 gene.
Authors:Kong X, Zhang W, Lockey RF, Auais A, Piedimonte G, Mohapatra SS.
Journal:Genet Vaccines Ther. 2007 Feb 1;5:4.
Entrez:17270047
siRNA sequence "gugauucaacaaugaccaa" alignment with "Human Respiratory Syncytial Virus [HRSV]" virus reference Genome sequences
siRNA sequence matching with "gugauucaacaaugaccaa" Human Respiratory Syncytial Virus [HRSV]" Virus reference Genome sequences
Browse all the records for "Human Respiratory Syncytial Virus [HRSV]" virus
Browse "virsi2171 " record
Length: 19
GC Content:37 %
GenBank Acc: U35029
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):60
Length: 19
GC Content:37 %
GenBank Acc: U35029
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):60
Offtargets for "gugauucaacaaugaccaa" siRNA in Human Genome sequences
See U35029 at Genbank
Pubmed:17151097
Article:Nonstructural proteins of respiratory syncytial virus suppress premature apoptosis by an NF-kappaB-dependent, interferon-independent mechanism and facilitate virus growth.
Authors:Bitko V, Shulyayeva O, Mazumder B, Musiyenko A, Ramaswamy M, Look DC, Barik S.
Journal:J Virol. 2007 Feb;81(4):1786-95. Epub 2006 Dec 6.
Entrez:17151097
Article:Nonstructural proteins of respiratory syncytial virus suppress premature apoptosis by an NF-kappaB-dependent, interferon-independent mechanism and facilitate virus growth.
Authors:Bitko V, Shulyayeva O, Mazumder B, Musiyenko A, Ramaswamy M, Look DC, Barik S.
Journal:J Virol. 2007 Feb;81(4):1786-95. Epub 2006 Dec 6.
Entrez:17151097
siRNA sequence "gacaugagaccguugucac" alignment with "Human Respiratory Syncytial Virus [HRSV]" virus reference Genome sequences
siRNA sequence matching with "gacaugagaccguugucac" Human Respiratory Syncytial Virus [HRSV]" Virus reference Genome sequences
Browse all the records for "Human Respiratory Syncytial Virus [HRSV]" virus
Browse "virsi2172 " record
Length: 19
GC Content:53 %
GenBank Acc: U35029
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):60
Length: 19
GC Content:53 %
GenBank Acc: U35029
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):60
Offtargets for "gacaugagaccguugucac" siRNA in Human Genome sequences
See U35029 at Genbank
Pubmed:17151097
Article:Nonstructural proteins of respiratory syncytial virus suppress premature apoptosis by an NF-kappaB-dependent, interferon-independent mechanism and facilitate virus growth.
Authors:Bitko V, Shulyayeva O, Mazumder B, Musiyenko A, Ramaswamy M, Look DC, Barik S.
Journal:J Virol. 2007 Feb;81(4):1786-95. Epub 2006 Dec 6.
Entrez:17151097
Article:Nonstructural proteins of respiratory syncytial virus suppress premature apoptosis by an NF-kappaB-dependent, interferon-independent mechanism and facilitate virus growth.
Authors:Bitko V, Shulyayeva O, Mazumder B, Musiyenko A, Ramaswamy M, Look DC, Barik S.
Journal:J Virol. 2007 Feb;81(4):1786-95. Epub 2006 Dec 6.
Entrez:17151097
siRNA sequence "cccuacaccaagugauaau" alignment with "Human Respiratory Syncytial Virus [HRSV]" virus reference Genome sequences
siRNA sequence matching with "cccuacaccaagugauaau" Human Respiratory Syncytial Virus [HRSV]" Virus reference Genome sequences
Browse all the records for "Human Respiratory Syncytial Virus [HRSV]" virus
Browse "virsi2017 " record
Length: 19
GC Content:42 %
Strain of Virus: Long Strain
GenBank Acc: AF035006
Length: 19
GC Content:42 %
Strain of Virus: Long Strain
GenBank Acc: AF035006
Offtargets for "cccuacaccaagugauaau" siRNA in Human Genome sequences
See AF035006 at Genbank
Pubmed:15619632
Article:Inhibition of respiratory viruses by nasally administered siRNA.
Authors:Bitko V, Musiyenko A, Shulyayeva O, Barik S.
Journal:Nat Med. 2005 Jan;11(1):50-5. Epub 2004 Dec 26.
Entrez:15619632
Article:Inhibition of respiratory viruses by nasally administered siRNA.
Authors:Bitko V, Musiyenko A, Shulyayeva O, Barik S.
Journal:Nat Med. 2005 Jan;11(1):50-5. Epub 2004 Dec 26.
Entrez:15619632
siRNA sequence "cgauaauauaacugcaaga" alignment with "Human Respiratory Syncytial Virus [HRSV]" virus reference Genome sequences
siRNA sequence matching with "cgauaauauaacugcaaga" Human Respiratory Syncytial Virus [HRSV]" Virus reference Genome sequences
Browse all the records for "Human Respiratory Syncytial Virus [HRSV]" virus
Browse "virsi2018 " record
Length: 19
GC Content:32 %
Strain of Virus: Long Strain
GenBank Acc: AF035006
Length: 19
GC Content:32 %
Strain of Virus: Long Strain
GenBank Acc: AF035006
Offtargets for "cgauaauauaacugcaaga" siRNA in Human Genome sequences
See AF035006 at Genbank
Pubmed:15619632
Article:Inhibition of respiratory viruses by nasally administered siRNA.
Authors:Bitko V, Musiyenko A, Shulyayeva O, Barik S.
Journal:Nat Med. 2005 Jan;11(1):50-5. Epub 2004 Dec 26.
Entrez:15619632
Article:Inhibition of respiratory viruses by nasally administered siRNA.
Authors:Bitko V, Musiyenko A, Shulyayeva O, Barik S.
Journal:Nat Med. 2005 Jan;11(1):50-5. Epub 2004 Dec 26.
Entrez:15619632
siRNA sequence "gcaauucauugaguaugcu" alignment with "Human Respiratory Syncytial Virus [HRSV]" virus reference Genome sequences
siRNA sequence matching with "gcaauucauugaguaugcu" Human Respiratory Syncytial Virus [HRSV]" Virus reference Genome sequences
Browse all the records for "Human Respiratory Syncytial Virus [HRSV]" virus
Offtargets for "gcaauucauugaguaugcu" siRNA in Human Genome sequences
See M74568 at Genbank
Pubmed:15619625
Article:Inhibition of respiratory syncytial virus infection with intranasal siRNA nanoparticles targeting the viral NS1 gene.
Authors:Zhang W, Yang H, Kong X, Mohapatra S, San Juan-Vergara H, Hellermann G, Behera S, Singam R, Lockey RF, Mohapatra SS.
Journal:Nat Med. 2005 Jan;11(1):56-62. Epub 2004 Dec 26. Erratum in: Nat Med. 2005 Feb;11(2):233.
Entrez:15619625
Article:Inhibition of respiratory syncytial virus infection with intranasal siRNA nanoparticles targeting the viral NS1 gene.
Authors:Zhang W, Yang H, Kong X, Mohapatra S, San Juan-Vergara H, Hellermann G, Behera S, Singam R, Lockey RF, Mohapatra SS.
Journal:Nat Med. 2005 Jan;11(1):56-62. Epub 2004 Dec 26. Erratum in: Nat Med. 2005 Feb;11(2):233.
Entrez:15619625
siRNA sequence "aagcccuauaacaucaaauucaa" alignment with "Human Respiratory Syncytial Virus [HRSV]" virus reference Genome sequences
siRNA sequence matching with "aagcccuauaacaucaaauucaa" Human Respiratory Syncytial Virus [HRSV]" Virus reference Genome sequences
Browse all the records for "Human Respiratory Syncytial Virus [HRSV]" virus
Offtargets for "aagcccuauaacaucaaauucaa" siRNA in Human Genome sequences
See AF035006 at Genbank
Pubmed:17050596
Article:Viral infection of the lungs through the eye.
Authors:Bitko V, Musiyenko A, Barik S.
Journal:J Virol. 2007 Jan;81(2):783-90. Epub 2006 Oct 18.
Entrez:17050596
Article:Viral infection of the lungs through the eye.
Authors:Bitko V, Musiyenko A, Barik S.
Journal:J Virol. 2007 Jan;81(2):783-90. Epub 2006 Oct 18.
Entrez:17050596
Virus_Name
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm