VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 16111658 are 6
Results from 0 - 25

siRNA sequence "aacauggagaacaucacauca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aacauggagaacaucacauca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1027 " record
Length: 21
GC Content:38 %
Starting position: 1028
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72

Offtargets for "aacauggagaacaucacauca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658

siRNA sequence "aaccucaauguuaguauuccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaccucaauguuaguauuccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1026 " record
Length: 21
GC Content:33 %
Starting position: 133
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72

Offtargets for "aaccucaauguuaguauuccu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658

siRNA sequence "aacaucacaucaggauuccua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aacaucacaucaggauuccua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1028 " record
Length: 21
GC Content:38 %
Starting position: 1037
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72

Offtargets for "aacaucacaucaggauuccua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658

siRNA sequence "aagaggacucuuggacucucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaggacucuuggacucucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1030 " record
Length: 21
GC Content:48 %
Starting position: 283
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72

Offtargets for "aagaggacucuuggacucucu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658

siRNA sequence "aacgaccgaccuugaggcaua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aacgaccgaccuugaggcaua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1031 " record
Length: 21
GC Content:52 %
Starting position: 312
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72

Offtargets for "aacgaccgaccuugaggcaua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658

siRNA sequence "aauguugcccaaggucuuaca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aauguugcccaaggucuuaca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1029 " record
Length: 21
GC Content:43 %
Starting position: 261
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72

Offtargets for "aauguugcccaaggucuuaca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1027	aacauggagaacaucacauca	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	85	16111658	Blast SL	refseqs
virsi1026	aaccucaauguuaguauuccu	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	75	16111658	Blast SL	refseqs
virsi1028	aacaucacaucaggauuccua	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	75	16111658	Blast SL	refseqs
virsi1030	aagaggacucuuggacucucu	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	75	16111658	Blast SL	refseqs
virsi1031	aacgaccgaccuugaggcaua	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	75	16111658	Blast SL	refseqs
virsi1029	aauguugcccaaggucuuaca	Hepatitis B Virus [HBV]	P	HepG2.2.15	Protein	65	16111658	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm