Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 16111658 are 6
Results from 0 - 25
siRNA sequence "aacauggagaacaucacauca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aacauggagaacaucacauca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1027 " record
Length: 21
GC Content:38 %
Starting position: 1028
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72
Length: 21
GC Content:38 %
Starting position: 1028
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72
Offtargets for "aacauggagaacaucacauca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658
siRNA sequence "aaccucaauguuaguauuccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaccucaauguuaguauuccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1026 " record
Length: 21
GC Content:33 %
Starting position: 133
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72
Length: 21
GC Content:33 %
Starting position: 133
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72
Offtargets for "aaccucaauguuaguauuccu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658
siRNA sequence "aacaucacaucaggauuccua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aacaucacaucaggauuccua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1028 " record
Length: 21
GC Content:38 %
Starting position: 1037
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72
Length: 21
GC Content:38 %
Starting position: 1037
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72
Offtargets for "aacaucacaucaggauuccua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658
siRNA sequence "aagaggacucuuggacucucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaggacucuuggacucucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1030 " record
Length: 21
GC Content:48 %
Starting position: 283
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72
Length: 21
GC Content:48 %
Starting position: 283
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72
Offtargets for "aagaggacucuuggacucucu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658
siRNA sequence "aacgaccgaccuugaggcaua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aacgaccgaccuugaggcaua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1031 " record
Length: 21
GC Content:52 %
Starting position: 312
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72
Length: 21
GC Content:52 %
Starting position: 312
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72
Offtargets for "aacgaccgaccuugaggcaua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658
siRNA sequence "aauguugcccaaggucuuaca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aauguugcccaaggucuuaca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1029 " record
Length: 21
GC Content:43 %
Starting position: 261
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72
Length: 21
GC Content:43 %
Starting position: 261
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: siPORT
Incubation Time (Hours):72
Offtargets for "aauguugcccaaggucuuaca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658
Article:Stable inhibition of hepatitis B virus expression and replication by expressed siRNA.
Authors:Ren GL, Bai XF, Zhang Y, Chen HM, Huang CX, Wang PZ, Li GY, Zhang Y, Lian JQ.
Journal:Biochem Biophys Res Commun. 2005 Oct 7;335(4):1051-9.
Entrez:16111658
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1027 | aacauggagaacaucacauca | Hepatitis B Virus [HBV] |  SL | refseqs |  | |||||
| virsi1026 | aaccucaauguuaguauuccu | Hepatitis B Virus [HBV] | SL | refseqs |  | |||||
| virsi1028 | aacaucacaucaggauuccua | Hepatitis B Virus [HBV] |  SL | refseqs |  | |||||
| virsi1030 | aagaggacucuuggacucucu | Hepatitis B Virus [HBV] | SL | refseqs |  | |||||
| virsi1031 | aacgaccgaccuugaggcaua | Hepatitis B Virus [HBV] | SL | refseqs |  | |||||
| virsi1029 | aauguugcccaaggucuuaca | Hepatitis B Virus [HBV] | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands: siRNA Not specific SL: siRNA seedlocator algorithm