Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for Poxviridae are 4
Results from 0 - 25
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1408 | aauaucgucggagcuguacac | Vaccinia | ![]() | refseqs |      ![]() | |||||
virsi1410 | aauacucucccgucgaugucu | Vaccinia | ![]() | refseqs |      ![]() | |||||
virsi1411 | aagacuuaugauccucucuca | Vaccinia | ![]() | refseqs |      ![]() | |||||
virsi1409 | aacgcucgucaauauagaucu | Vaccinia | ![]() | refseqs |      ![]() |



SL: siRNA seedlocator algorithm