VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 16254373 are 7
Results from 0 - 25

siRNA sequence "ggcuccucugccgauccauac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggcuccucugccgauccauac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1081 " record
Length: 21
GC Content:62 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggcuccucugccgauccauac" siRNA in Human Genome sequences
See at Genbank
Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "ggcugcuaugccucaucuucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggcugcuaugccucaucuucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1080 " record
Length: 21
GC Content:52 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggcugcuaugccucaucuucu" siRNA in Human Genome sequences
See at Genbank
Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "gccuaugggagugggccucag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gccuaugggagugggccucag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1082 " record
Length: 21
GC Content:67 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "gccuaugggagugggccucag" siRNA in Human Genome sequences
See at Genbank
Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "ggaagaagaacucccucgccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggaagaagaacucccucgccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1084 " record
Length: 21
GC Content:57 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggaagaagaacucccucgccu" siRNA in Human Genome sequences
See at Genbank
Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "ggacucgugguggacuucucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggacucgugguggacuucucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1085 " record
Length: 21
GC Content:57 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggacucgugguggacuucucu" siRNA in Human Genome sequences
See at Genbank
Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "ggaagccuccaagcugugccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggaagccuccaagcugugccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1083 " record
Length: 21
GC Content:62 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggaagccuccaagcugugccu" siRNA in Human Genome sequences
See at Genbank
Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "ggccaaguguuugcugacgca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggccaaguguuugcugacgca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1086 " record
Length: 21
GC Content:57 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggccaaguguuugcugacgca" siRNA in Human Genome sequences
See at Genbank
Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1081	ggcuccucugccgauccauac	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	88	16254373	Blast SL	refseqs
virsi1080	ggcugcuaugccucaucuucu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	67	16254373	Blast SL	refseqs
virsi1082	gccuaugggagugggccucag	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	22	16254373	Blast SL	refseqs
virsi1084	ggaagaagaacucccucgccu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	22	16254373	Blast SL	refseqs
virsi1085	ggacucgugguggacuucucu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	20	16254373	Blast SL	refseqs
virsi1083	ggaagccuccaagcugugccu	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	19	16254373	Blast SL	refseqs
virsi1086	ggccaaguguuugcugacgca	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	15	16254373	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm