Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for E6 are 42
Results from 0 - 25
siRNA sequence "aagagcugaaacaacuauac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aagagcugaaacaacuauac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2181 " record
Length: 20
GC Content:35 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Length: 20
GC Content:35 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Offtargets for "aagagcugaaacaacuauac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658
siRNA sequence "ggucgauguaugucuuguugc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggucgauguaugucuuguugc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1712 " record
Length: 21
GC Content:48 %
Starting position: 503
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 21
GC Content:48 %
Starting position: 503
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "ggucgauguaugucuuguugc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559
siRNA sequence "agguauuugaauuugcauu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agguauuugaauuugcauu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1733 " record
Length: 19
GC Content:26 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001357
Incubation Time (Hours):48
Length: 19
GC Content:26 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001357
Incubation Time (Hours):48
Offtargets for "agguauuugaauuugcauu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16810314
Article:Inhibition of cervical cancer cell growth in vitro and in vivo with lentiviral-vector delivered short hairpin RNA targeting human papillomavirus E6 and E7 oncogenes.
Authors:Gu W, Putral L, Hengst K, Minto K, Saunders NA, Leggatt G, McMillan NA.
Journal:Cancer Gene Ther. 2006 Nov;13(11):1023-32. Epub 2006 Jun 30.
Entrez:16810314
Article:Inhibition of cervical cancer cell growth in vitro and in vivo with lentiviral-vector delivered short hairpin RNA targeting human papillomavirus E6 and E7 oncogenes.
Authors:Gu W, Putral L, Hengst K, Minto K, Saunders NA, Leggatt G, McMillan NA.
Journal:Cancer Gene Ther. 2006 Nov;13(11):1023-32. Epub 2006 Jun 30.
Entrez:16810314
siRNA sequence "cuaacuaacacuggguuau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2353 " record
Length: 19
GC Content:37 %
Strain of Virus: HPV18
Transfection Reagent: Oligofectamine
Length: 19
GC Content:37 %
Strain of Virus: HPV18
Transfection Reagent: Oligofectamine
Offtargets for "cuaacuaacacuggguuau" siRNA in Human Genome sequences
Pubmed:21630254
Article:The synergistic therapeutic effect of cisplatin with Human papillomavirus E6/E7 short interfering RNA on cervical cancer cell lines in vitro and in vivo.
Authors:Jung HS, Erkin OC, Kwon MJ, Kim SH, Jung JI, Oh YK, Her SW, Ju W, Choi YL, Song SY, Kim JK, Kim YD, Shim GY, Shin YK. Int J Cancer. 2011 May 31. doi: 10.1002/ijc.26197. [Epub ahead of print] Int J Cancer. 2011 21630254
Journal:
Entrez:
Article:The synergistic therapeutic effect of cisplatin with Human papillomavirus E6/E7 short interfering RNA on cervical cancer cell lines in vitro and in vivo.
Authors:Jung HS, Erkin OC, Kwon MJ, Kim SH, Jung JI, Oh YK, Her SW, Ju W, Choi YL, Song SY, Kim JK, Kim YD, Shim GY, Shin YK. Int J Cancer. 2011 May 31. doi: 10.1002/ijc.26197. [Epub ahead of print] Int J Cancer. 2011 21630254
Journal:
Entrez:
siRNA sequence "gacauuauucagacucugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gacauuauucagacucugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1728 " record
Length: 19
GC Content:37 %
Starting position: 340
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):96
Length: 19
GC Content:37 %
Starting position: 340
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):96
Offtargets for "gacauuauucagacucugu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516
siRNA sequence "gcaacaguuacugcgacgu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaacaguuacugcgacgu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1762 " record
Length: 19
GC Content:53 %
Starting position: 205
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Length: 19
GC Content:53 %
Starting position: 205
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Offtargets for "gcaacaguuacugcgacgu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18369785
Article:siRNA and shRNA as anticancer agents in a cervical cancer model.
Authors:Gu W, Putral L, McMillan N.
Journal:Methods Mol Biol. 2008;442:159-72.
Entrez:18369785
Article:siRNA and shRNA as anticancer agents in a cervical cancer model.
Authors:Gu W, Putral L, McMillan N.
Journal:Methods Mol Biol. 2008;442:159-72.
Entrez:18369785
siRNA sequence "agguauuugaauuugcauu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agguauuugaauuugcauu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1763 " record
Length: 19
GC Content:26 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001526
Incubation Time (Hours):72
Length: 19
GC Content:26 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001526
Incubation Time (Hours):72
Offtargets for "agguauuugaauuugcauu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18369785
Article:siRNA and shRNA as anticancer agents in a cervical cancer model.
Authors:Gu W, Putral L, McMillan N.
Journal:Methods Mol Biol. 2008;442:159-72.
Entrez:18369785
Article:siRNA and shRNA as anticancer agents in a cervical cancer model.
Authors:Gu W, Putral L, McMillan N.
Journal:Methods Mol Biol. 2008;442:159-72.
Entrez:18369785
siRNA sequence "cacuucacugcaagacaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cacuucacugcaagacaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1710 " record
Length: 19
GC Content:42 %
Starting position: 166
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Length: 19
GC Content:42 %
Starting position: 166
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Offtargets for "cacuucacugcaagacaua" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212
siRNA sequence "cucuguguauggagacaca" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cucuguguauggagacaca" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2169 " record
Length: 19
GC Content:47 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 19
GC Content:47 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "cucuguguauggagacaca" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884
siRNA sequence "uggaguuaaucaucaacau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uggaguuaaucaucaacau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2170 " record
Length: 19
GC Content:32 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 19
GC Content:32 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "uggaguuaaucaucaacau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884
siRNA sequence "uacaacaaaccguugugug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uacaacaaaccguugugug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1703 " record
Length: 19
GC Content:42 %
Starting position: 377
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 377
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Offtargets for "uacaacaaaccguugugug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:12955072
Article:siRNA targeting of the viral E6 oncogene efficiently kills human papillomavirus-positive cancer cells.
Authors:Butz K, Ristriani T, Hengstermann A, Denk C, Scheffner M, Hoppe-Seyler F.
Journal:Oncogene. 2003 Sep 4;22(38):5938-45.
Entrez:12955072
Article:siRNA targeting of the viral E6 oncogene efficiently kills human papillomavirus-positive cancer cells.
Authors:Butz K, Ristriani T, Hengstermann A, Denk C, Scheffner M, Hoppe-Seyler F.
Journal:Oncogene. 2003 Sep 4;22(38):5938-45.
Entrez:12955072
siRNA sequence "aacugcgacgugagguauaug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aacugcgacgugagguauaug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2182 " record
Length: 21
GC Content:48 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Offtargets for "aacugcgacgugagguauaug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658
siRNA sequence "gagguauaugacuuugcuuuu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gagguauaugacuuugcuuuu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1713 " record
Length: 21
GC Content:33 %
Starting position: 224
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine
Incubation Time (Hours):24
Length: 21
GC Content:33 %
Starting position: 224
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine
Incubation Time (Hours):24
Offtargets for "gagguauaugacuuugcuuuu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559
siRNA sequence "ccuguguauauugcaagac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccuguguauauugcaagac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1701 " record
Length: 19
GC Content:42 %
Starting position: 196
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 196
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48
Offtargets for "ccuguguauauugcaagac" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16138119
Article:Induction of cell death in human papillomavirus 18-positive cervical cancer cells by E6 siRNA.
Authors:Yamato K, Fen J, Kobuchi H, Nasu Y, Yamada T, Nishihara T, Ikeda Y, Kizaki M, Yoshinouchi M.
Journal:Cancer Gene Ther. 2006 Mar;13(3):234-41.
Entrez:16138119
Article:Induction of cell death in human papillomavirus 18-positive cervical cancer cells by E6 siRNA.
Authors:Yamato K, Fen J, Kobuchi H, Nasu Y, Yamada T, Nishihara T, Ikeda Y, Kizaki M, Yoshinouchi M.
Journal:Cancer Gene Ther. 2006 Mar;13(3):234-41.
Entrez:16138119
siRNA sequence "gagguauuugaauuugcau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gagguauuugaauuugcau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1700 " record
Length: 19
GC Content:32 %
Starting position: 231
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48
Length: 19
GC Content:32 %
Starting position: 231
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48
Offtargets for "gagguauuugaauuugcau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16138119
Article:Induction of cell death in human papillomavirus 18-positive cervical cancer cells by E6 siRNA.
Authors:Yamato K, Fen J, Kobuchi H, Nasu Y, Yamada T, Nishihara T, Ikeda Y, Kizaki M, Yoshinouchi M.
Journal:Cancer Gene Ther. 2006 Mar;13(3):234-41.
Entrez:16138119
Article:Induction of cell death in human papillomavirus 18-positive cervical cancer cells by E6 siRNA.
Authors:Yamato K, Fen J, Kobuchi H, Nasu Y, Yamada T, Nishihara T, Ikeda Y, Kizaki M, Yoshinouchi M.
Journal:Cancer Gene Ther. 2006 Mar;13(3):234-41.
Entrez:16138119
siRNA sequence "agguauuugaauuugcau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agguauuugaauuugcau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1726 " record
Length: 18
GC Content:28 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 18
GC Content:28 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "agguauuugaauuugcau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770
siRNA sequence "uguguguacugcaagcaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uguguguacugcaagcaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1720 " record
Length: 19
GC Content:47 %
Starting position: 191
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days
Length: 19
GC Content:47 %
Starting position: 191
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days
Offtargets for "uguguguacugcaagcaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752
siRNA sequence "caguuacugcgacgugaggu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "caguuacugcgacgugaggu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1721 " record
Length: 20
GC Content:55 %
Starting position: 209
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days
Length: 20
GC Content:55 %
Starting position: 209
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days
Offtargets for "caguuacugcgacgugaggu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752
siRNA sequence "uguguacugcaagcaacag" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uguguacugcaagcaacag" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1704 " record
Length: 19
GC Content:47 %
Starting position: 193
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: TransMessenger
Incubation Time (Hours):48
Length: 19
GC Content:47 %
Starting position: 193
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: TransMessenger
Incubation Time (Hours):48
Offtargets for "uguguacugcaagcaacag" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681755
Article:Inhibition of HPV 16 E6 oncogene expression by RNA interference in vitro and in vivo.
Authors:Niu XY, Peng ZL, Duan WQ, Wang H, Wang P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):743-51.
Entrez:16681755
Article:Inhibition of HPV 16 E6 oncogene expression by RNA interference in vitro and in vivo.
Authors:Niu XY, Peng ZL, Duan WQ, Wang H, Wang P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):743-51.
Entrez:16681755
siRNA sequence "gcaacaguuacugcgacgu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaacaguuacugcgacgu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1724 " record
Length: 19
GC Content:53 %
Starting position: 205
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 19
GC Content:53 %
Starting position: 205
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "gcaacaguuacugcgacgu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770
siRNA sequence "cacguagagaaacccagcu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cacguagagaaacccagcu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1725 " record
Length: 19
GC Content:53 %
Starting position: 537
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 19
GC Content:53 %
Starting position: 537
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "cacguagagaaacccagcu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770
siRNA sequence "cuaacuaacacuggguuau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cuaacuaacacuggguuau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1702 " record
Length: 19
GC Content:37 %
Starting position: 381
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Length: 19
GC Content:37 %
Starting position: 381
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Offtargets for "cuaacuaacacuggguuau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:12955072
Article:siRNA targeting of the viral E6 oncogene efficiently kills human papillomavirus-positive cancer cells.
Authors:Butz K, Ristriani T, Hengstermann A, Denk C, Scheffner M, Hoppe-Seyler F.
Journal:Oncogene. 2003 Sep 4;22(38):5938-45.
Entrez:12955072
Article:siRNA targeting of the viral E6 oncogene efficiently kills human papillomavirus-positive cancer cells.
Authors:Butz K, Ristriani T, Hengstermann A, Denk C, Scheffner M, Hoppe-Seyler F.
Journal:Oncogene. 2003 Sep 4;22(38):5938-45.
Entrez:12955072
siRNA sequence "gaccggucgauguaugucuug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gaccggucgauguaugucuug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1756 " record
Length: 21
GC Content:52 %
Starting position: 499
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:52 %
Starting position: 499
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gaccggucgauguaugucuug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144
siRNA sequence "gagguauaugacuuugcuu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gagguauaugacuuugcuu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1698 " record
Length: 19
GC Content:37 %
Starting position: 224
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Length: 19
GC Content:37 %
Starting position: 224
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Offtargets for "gagguauaugacuuugcuu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:12203116
Article:Selective silencing of viral gene expression in HPV-positive human cervical carcinoma cells treated with siRNA, a primer of RNA interference.
Authors:Jiang M, Milner J.
Journal:Oncogene. 2002 Sep 5;21(39):6041-8.
Entrez:12203116
Article:Selective silencing of viral gene expression in HPV-positive human cervical carcinoma cells treated with siRNA, a primer of RNA interference.
Authors:Jiang M, Milner J.
Journal:Oncogene. 2002 Sep 5;21(39):6041-8.
Entrez:12203116
siRNA sequence "gaauguguguacugcaagc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gaauguguguacugcaagc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1697 " record
Length: 19
GC Content:47 %
Starting position: 188
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 19
GC Content:47 %
Starting position: 188
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "gaauguguguacugcaagc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:14599809
Article:In vitro and in vivo growth suppression of human papillomavirus 16-positive cervical cancer cells by E6 siRNA.
Authors:Yoshinouchi M, Yamada T, Kizaki M, Fen J, Koseki T, Ikeda Y, Nishihara T, Yamato K.
Journal:Mol Ther. 2003 Nov;8(5):762-8.
Entrez:14599809
Article:In vitro and in vivo growth suppression of human papillomavirus 16-positive cervical cancer cells by E6 siRNA.
Authors:Yoshinouchi M, Yamada T, Kizaki M, Fen J, Koseki T, Ikeda Y, Nishihara T, Yamato K.
Journal:Mol Ther. 2003 Nov;8(5):762-8.
Entrez:14599809
Virus_Name
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm