VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for E6 are 42
Results from 0 - 25

« previous12next »
siRNA sequence "aagagcugaaacaacuauac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aagagcugaaacaacuauac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2181 " record
Length: 20
GC Content:35 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "aagagcugaaacaacuauac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658

siRNA sequence "ggucgauguaugucuuguugc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggucgauguaugucuuguugc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1712 " record
Length: 21
GC Content:48 %
Starting position: 503
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "ggucgauguaugucuuguugc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559

siRNA sequence "agguauuugaauuugcauu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agguauuugaauuugcauu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1733 " record
Length: 19
GC Content:26 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001357
Incubation Time (Hours):48

Offtargets for "agguauuugaauuugcauu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16810314
Article:Inhibition of cervical cancer cell growth in vitro and in vivo with lentiviral-vector delivered short hairpin RNA targeting human papillomavirus E6 and E7 oncogenes.
Authors:Gu W, Putral L, Hengst K, Minto K, Saunders NA, Leggatt G, McMillan NA.
Journal:Cancer Gene Ther. 2006 Nov;13(11):1023-32. Epub 2006 Jun 30.
Entrez:16810314

siRNA sequence "cuaacuaacacuggguuau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2353 " record
Length: 19
GC Content:37 %
Strain of Virus: HPV18
Transfection Reagent: Oligofectamine

Offtargets for "cuaacuaacacuggguuau" siRNA in Human Genome sequences
See at Genbank
Pubmed:21630254
Article:The synergistic therapeutic effect of cisplatin with Human papillomavirus E6/E7 short interfering RNA on cervical cancer cell lines in vitro and in vivo.
Authors:Jung HS, Erkin OC, Kwon MJ, Kim SH, Jung JI, Oh YK, Her SW, Ju W, Choi YL, Song SY, Kim JK, Kim YD, Shim GY, Shin YK. Int J Cancer. 2011 May 31. doi: 10.1002/ijc.26197. [Epub ahead of print] Int J Cancer. 2011 21630254
Journal:
Entrez:

siRNA sequence "gacauuauucagacucugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gacauuauucagacucugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1728 " record
Length: 19
GC Content:37 %
Starting position: 340
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):96

Offtargets for "gacauuauucagacucugu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516

siRNA sequence "gcaacaguuacugcgacgu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaacaguuacugcgacgu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1762 " record
Length: 19
GC Content:53 %
Starting position: 205
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "gcaacaguuacugcgacgu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18369785
Article:siRNA and shRNA as anticancer agents in a cervical cancer model.
Authors:Gu W, Putral L, McMillan N.
Journal:Methods Mol Biol. 2008;442:159-72.
Entrez:18369785

siRNA sequence "agguauuugaauuugcauu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agguauuugaauuugcauu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1763 " record
Length: 19
GC Content:26 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001526
Incubation Time (Hours):72

Offtargets for "agguauuugaauuugcauu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18369785
Article:siRNA and shRNA as anticancer agents in a cervical cancer model.
Authors:Gu W, Putral L, McMillan N.
Journal:Methods Mol Biol. 2008;442:159-72.
Entrez:18369785

siRNA sequence "cacuucacugcaagacaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cacuucacugcaagacaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1710 " record
Length: 19
GC Content:42 %
Starting position: 166
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72

Offtargets for "cacuucacugcaagacaua" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212

siRNA sequence "cucuguguauggagacaca" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cucuguguauggagacaca" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2169 " record
Length: 19
GC Content:47 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "cucuguguauggagacaca" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884

siRNA sequence "uggaguuaaucaucaacau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uggaguuaaucaucaacau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2170 " record
Length: 19
GC Content:32 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "uggaguuaaucaucaacau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884

siRNA sequence "uacaacaaaccguugugug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uacaacaaaccguugugug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1703 " record
Length: 19
GC Content:42 %
Starting position: 377
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "uacaacaaaccguugugug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:12955072
Article:siRNA targeting of the viral E6 oncogene efficiently kills human papillomavirus-positive cancer cells.
Authors:Butz K, Ristriani T, Hengstermann A, Denk C, Scheffner M, Hoppe-Seyler F.
Journal:Oncogene. 2003 Sep 4;22(38):5938-45.
Entrez:12955072

siRNA sequence "aacugcgacgugagguauaug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aacugcgacgugagguauaug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2182 " record
Length: 21
GC Content:48 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "aacugcgacgugagguauaug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658

siRNA sequence "gagguauaugacuuugcuuuu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gagguauaugacuuugcuuuu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1713 " record
Length: 21
GC Content:33 %
Starting position: 224
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine
Incubation Time (Hours):24

Offtargets for "gagguauaugacuuugcuuuu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559

siRNA sequence "ccuguguauauugcaagac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccuguguauauugcaagac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1701 " record
Length: 19
GC Content:42 %
Starting position: 196
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "ccuguguauauugcaagac" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16138119
Article:Induction of cell death in human papillomavirus 18-positive cervical cancer cells by E6 siRNA.
Authors:Yamato K, Fen J, Kobuchi H, Nasu Y, Yamada T, Nishihara T, Ikeda Y, Kizaki M, Yoshinouchi M.
Journal:Cancer Gene Ther. 2006 Mar;13(3):234-41.
Entrez:16138119

siRNA sequence "gagguauuugaauuugcau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gagguauuugaauuugcau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1700 " record
Length: 19
GC Content:32 %
Starting position: 231
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "gagguauuugaauuugcau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16138119
Article:Induction of cell death in human papillomavirus 18-positive cervical cancer cells by E6 siRNA.
Authors:Yamato K, Fen J, Kobuchi H, Nasu Y, Yamada T, Nishihara T, Ikeda Y, Kizaki M, Yoshinouchi M.
Journal:Cancer Gene Ther. 2006 Mar;13(3):234-41.
Entrez:16138119

siRNA sequence "agguauuugaauuugcau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agguauuugaauuugcau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1726 " record
Length: 18
GC Content:28 %
Starting position: 232
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "agguauuugaauuugcau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770

siRNA sequence "uguguguacugcaagcaac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uguguguacugcaagcaac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1720 " record
Length: 19
GC Content:47 %
Starting position: 191
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "uguguguacugcaagcaac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "caguuacugcgacgugaggu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "caguuacugcgacgugaggu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1721 " record
Length: 20
GC Content:55 %
Starting position: 209
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Genejammer
Incubation Time (Hours):14 Days

Offtargets for "caguuacugcgacgugaggu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681752
Article:Extended effects of human papillomavirus 16 E6-specific short hairpin RNA on cervical carcinoma cells.
Authors:Bai L, Wei L, Wang J, Li X, He P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):718-29.
Entrez:16681752

siRNA sequence "uguguacugcaagcaacag" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uguguacugcaagcaacag" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1704 " record
Length: 19
GC Content:47 %
Starting position: 193
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: TransMessenger
Incubation Time (Hours):48

Offtargets for "uguguacugcaagcaacag" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16681755
Article:Inhibition of HPV 16 E6 oncogene expression by RNA interference in vitro and in vivo.
Authors:Niu XY, Peng ZL, Duan WQ, Wang H, Wang P.
Journal:Int J Gynecol Cancer. 2006 Mar-Apr;16(2):743-51.
Entrez:16681755

siRNA sequence "gcaacaguuacugcgacgu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaacaguuacugcgacgu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1724 " record
Length: 19
GC Content:53 %
Starting position: 205
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "gcaacaguuacugcgacgu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770

siRNA sequence "cacguagagaaacccagcu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cacguagagaaacccagcu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1725 " record
Length: 19
GC Content:53 %
Starting position: 537
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "cacguagagaaacccagcu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16120770
Article:RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin.
Authors:Putral LN, Bywater MJ, Gu W, Saunders NA, Gabrielli BG, Leggatt GR, McMillan NA.
Journal:Mol Pharmacol. 2005 Nov;68(5):1311-9. Epub 2005 Aug 24.
Entrez:16120770

siRNA sequence "cuaacuaacacuggguuau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cuaacuaacacuggguuau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1702 " record
Length: 19
GC Content:37 %
Starting position: 381
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "cuaacuaacacuggguuau" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:12955072
Article:siRNA targeting of the viral E6 oncogene efficiently kills human papillomavirus-positive cancer cells.
Authors:Butz K, Ristriani T, Hengstermann A, Denk C, Scheffner M, Hoppe-Seyler F.
Journal:Oncogene. 2003 Sep 4;22(38):5938-45.
Entrez:12955072

siRNA sequence "gaccggucgauguaugucuug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gaccggucgauguaugucuug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1756 " record
Length: 21
GC Content:52 %
Starting position: 499
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gaccggucgauguaugucuug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144

siRNA sequence "gagguauaugacuuugcuu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gagguauaugacuuugcuu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1698 " record
Length: 19
GC Content:37 %
Starting position: 224
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "gagguauaugacuuugcuu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:12203116
Article:Selective silencing of viral gene expression in HPV-positive human cervical carcinoma cells treated with siRNA, a primer of RNA interference.
Authors:Jiang M, Milner J.
Journal:Oncogene. 2002 Sep 5;21(39):6041-8.
Entrez:12203116

siRNA sequence "gaauguguguacugcaagc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gaauguguguacugcaagc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1697 " record
Length: 19
GC Content:47 %
Starting position: 188
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24

Offtargets for "gaauguguguacugcaagc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:14599809
Article:In vitro and in vivo growth suppression of human papillomavirus 16-positive cervical cancer cells by E6 siRNA.
Authors:Yoshinouchi M, Yamada T, Kizaki M, Fen J, Koseki T, Ikeda Y, Nishihara T, Yamato K.
Journal:Mol Ther. 2003 Nov;8(5):762-8.
Entrez:14599809


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi2181	aagagcugaaacaacuauac	Human Papillomavirus [HPV]	E6	Upci:Scc090	mRNA	Medium	15763658	Blast SL	refseqs
virsi1712	ggucgauguaugucuuguugc	Human Papillomavirus [HPV]	E6	CaSki	mRNA	Medium	19174559	Blast SL	refseqs
virsi1733	agguauuugaauuugcauu	Human Papillomavirus [HPV]	E6	HeLa	Protein	Medium	16810314	Blast SL	refseqs
virsi2353	cuaacuaacacuggguuau	Human Papillomavirus [HPV]	E6	HeLa	mRNA	Medium	21630254	Blast SL	refseqs
virsi1728	gacauuauucagacucugu	Human Papillomavirus [HPV]	E6	HeLa	mRNA	Low	15908516	Blast SL	refseqs
virsi1762	gcaacaguuacugcgacgu	Human Papillomavirus [HPV]	E6	CaSki	Protein	Low	18369785	Blast SL	refseqs
virsi1763	agguauuugaauuugcauu	Human Papillomavirus [HPV]	E6	HeLa	RNA	Low	18369785	Blast SL	refseqs
virsi1710	cacuucacugcaagacaua	Human Papillomavirus [HPV]	E6	HeLa	Protein	High	17636212	Blast SL	refseqs
virsi2169	cucuguguauggagacaca	Human Papillomavirus [HPV]	E6	CaSki	mRNA	High	16611884	Blast SL	refseqs
virsi2170	uggaguuaaucaucaacau	Human Papillomavirus [HPV]	E6	CaSki	Protein	High	16611884	Blast SL	refseqs
virsi1703	uacaacaaaccguugugug	Human Papillomavirus [HPV]	E6	HeLa	mRNA	High	12955072	Blast SL	refseqs
virsi2182	aacugcgacgugagguauaug	Human Papillomavirus [HPV]	E6	Upci:Scc090	mRNA	High	15763658	Blast SL	refseqs
virsi1713	gagguauaugacuuugcuuuu	Human Papillomavirus [HPV]	E6	CaSki	mRNA	100	19174559	Blast SL	refseqs
virsi1701	ccuguguauauugcaagac	Human Papillomavirus [HPV]	E6	HeLa/SW756	mRNA	97	16138119	Blast SL	refseqs
virsi1700	gagguauuugaauuugcau	Human Papillomavirus [HPV]	E6	HeLa/SW756	mRNA	96	16138119	Blast SL	refseqs
virsi1726	agguauuugaauuugcau	Human Papillomavirus [HPV]	E6	CaSki	Protein	90	16120770	Blast SL	refseqs
virsi1720	uguguguacugcaagcaac	Human Papillomavirus [HPV]	E6	SiHa	mRNA	90	16681752	Blast SL	refseqs
virsi1721	caguuacugcgacgugaggu	Human Papillomavirus [HPV]	E6	SiHa	mRNA	85	16681752	Blast SL	refseqs
virsi1704	uguguacugcaagcaacag	Human Papillomavirus [HPV]	E6	CaSki	mRNA	83	16681755	Blast SL	refseqs
virsi1724	gcaacaguuacugcgacgu	Human Papillomavirus [HPV]	E6	CaSki	Protein	81	16120770	Blast SL	refseqs
virsi1725	cacguagagaaacccagcu	Human Papillomavirus [HPV]	E6	CaSki	Protein	79	16120770	Blast SL	refseqs
virsi1702	cuaacuaacacuggguuau	Human Papillomavirus [HPV]	E6	HeLa	mRNA	75	12955072	Blast SL	refseqs
virsi1756	gaccggucgauguaugucuug	Human Papillomavirus [HPV]	E6	SiHa	mRNA	73	18157144	Blast SL	refseqs
virsi1698	gagguauaugacuuugcuu	Human Papillomavirus [HPV]	E6	CaSki	mRNA	70	12203116	Blast SL	refseqs
virsi1697	gaauguguguacugcaagc	Human Papillomavirus [HPV]	E6	COS-1	mRNA	70	14599809	Blast SL	refseqs



« previous12next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm