Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for E7 are 39
Results from 0 - 25
siRNA sequence "uccauaugcuguaugugau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uccauaugcuguaugugau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2168 " record
Length: 19
GC Content:37 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 19
GC Content:37 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "uccauaugcuguaugugau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884
siRNA sequence "cauuuaccagcccgacgag" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cauuuaccagcccgacgag" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1717 " record
Length: 19
GC Content:58 %
Starting position: 731
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Length: 19
GC Content:58 %
Starting position: 731
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Offtargets for "cauuuaccagcccgacgag" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17589817
Article:Identification of cellular targets for the human papillomavirus E6 and E7 oncogenes by RNA interference and transcriptome analyses.
Authors:Kuner R, Vogt M, Sultmann H, Buness A, Dymalla S, Bulkescher J, Fellmann M, Butz K, Poustka A, Hoppe-Seyler F.
Journal:J Mol Med (Berl). 2007 Nov;85(11):1253-62. Epub 2007 Jun 23.
Entrez:17589817
Article:Identification of cellular targets for the human papillomavirus E6 and E7 oncogenes by RNA interference and transcriptome analyses.
Authors:Kuner R, Vogt M, Sultmann H, Buness A, Dymalla S, Bulkescher J, Fellmann M, Butz K, Poustka A, Hoppe-Seyler F.
Journal:J Mol Med (Berl). 2007 Nov;85(11):1253-62. Epub 2007 Jun 23.
Entrez:17589817
siRNA sequence "ccaccaacgucacacaaugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccaccaacgucacacaaugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1711 " record
Length: 20
GC Content:50 %
Starting position: 750
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Length: 20
GC Content:50 %
Starting position: 750
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Offtargets for "ccaccaacgucacacaaugu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212
Article:Silencing of HPV 18 oncoproteins With RNA interference causes growth inhibition of cervical cancer cells.
Authors:Lea JS, Sunaga N, Sato M, Kalahasti G, Miller DS, Minna JD, Muller CY.
Journal:Reprod Sci. 2007 Jan;14(1):20-8.
Entrez:17636212
siRNA sequence "gcacacacguagacauucg" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcacacacguagacauucg" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2167 " record
Length: 19
GC Content:53 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 19
GC Content:53 %
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "gcacacacguagacauucg" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884
Article:The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:J Virol. 2006 May;80(9):4249-63.
Entrez:16611884
siRNA sequence "ccacaacgucacacaaugu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccacaacgucacacaaugu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1718 " record
Length: 19
GC Content:47 %
Starting position: 755
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Length: 19
GC Content:47 %
Starting position: 755
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Offtargets for "ccacaacgucacacaaugu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:17589817
Article:Identification of cellular targets for the human papillomavirus E6 and E7 oncogenes by RNA interference and transcriptome analyses.
Authors:Kuner R, Vogt M, Sultmann H, Buness A, Dymalla S, Bulkescher J, Fellmann M, Butz K, Poustka A, Hoppe-Seyler F.
Journal:J Mol Med (Berl). 2007 Nov;85(11):1253-62. Epub 2007 Jun 23.
Entrez:17589817
Article:Identification of cellular targets for the human papillomavirus E6 and E7 oncogenes by RNA interference and transcriptome analyses.
Authors:Kuner R, Vogt M, Sultmann H, Buness A, Dymalla S, Bulkescher J, Fellmann M, Butz K, Poustka A, Hoppe-Seyler F.
Journal:J Mol Med (Berl). 2007 Nov;85(11):1253-62. Epub 2007 Jun 23.
Entrez:17589817
siRNA sequence "aggaggaugaaauagauggu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aggaggaugaaauagauggu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1715 " record
Length: 20
GC Content:40 %
Starting position: 662
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 20
GC Content:40 %
Starting position: 662
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "aggaggaugaaauagauggu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559
siRNA sequence "cacgagcaauuaagcga" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cacgagcaauuaagcga" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1743 " record
Length: 17
GC Content:47 %
Starting position: 671
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 17
GC Content:47 %
Starting position: 671
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "cacgagcaauuaagcga" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
siRNA sequence "gcauggagauacaccuaca" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcauggagauacaccuaca" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1766 " record
Length: 19
GC Content:47 %
Starting position: 564
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Length: 19
GC Content:47 %
Starting position: 564
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Offtargets for "gcauggagauacaccuaca" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18060502
Article:RNA interference against HPV16 E7 oncogene leads to viral E6 and E7 suppression in cervical cancer cells and apoptosis via upregulation of Rb and p53.
Authors:Sima N, Wang W, Kong D, Deng D, Xu Q, Zhou J, Xu G, Meng L, Lu Y, Wang S, Ma D.
Journal:Apoptosis. 2008 Feb;13(2):273-81.
Entrez:18060502
Article:RNA interference against HPV16 E7 oncogene leads to viral E6 and E7 suppression in cervical cancer cells and apoptosis via upregulation of Rb and p53.
Authors:Sima N, Wang W, Kong D, Deng D, Xu Q, Zhou J, Xu G, Meng L, Lu Y, Wang S, Ma D.
Journal:Apoptosis. 2008 Feb;13(2):273-81.
Entrez:18060502
siRNA sequence "ggaagaaaacgaugaaaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggaagaaaacgaugaaaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1731 " record
Length: 19
GC Content:32 %
Starting position: 694
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):96
Length: 19
GC Content:32 %
Starting position: 694
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):96
Offtargets for "ggaagaaaacgaugaaaua" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516
siRNA sequence "aggaggaugaaauagaugg" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aggaggaugaaauagaugg" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1767 " record
Length: 19
GC Content:42 %
Starting position: 662
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Length: 19
GC Content:42 %
Starting position: 662
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Offtargets for "aggaggaugaaauagaugg" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15665592
Article:Gel-based application of siRNA to human epithelial cancer cells induces RNAi-dependent apoptosis.
Authors:Jiang M, Rubbi CP, Milner J.
Journal:Oligonucleotides. 2004 Winter;14(4):239-48.
Entrez:15665592
Article:Gel-based application of siRNA to human epithelial cancer cells induces RNAi-dependent apoptosis.
Authors:Jiang M, Rubbi CP, Milner J.
Journal:Oligonucleotides. 2004 Winter;14(4):239-48.
Entrez:15665592
siRNA sequence "ucucuacuguuaugagcaauua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ucucuacuguuaugagcaauua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1740 " record
Length: 22
GC Content:32 %
Starting position: 624
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 22
GC Content:32 %
Starting position: 624
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "ucucuacuguuaugagcaauua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
siRNA sequence "ggcaacauugcaagacauu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ggcaacauugcaagacauu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1730 " record
Length: 19
GC Content:42 %
Starting position: 604
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 604
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Offtargets for "ggcaacauugcaagacauu" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516
Article:Chemotherapy compounds in cervical cancer cells primed by reconstitution of p53 function after short interfering RNA-mediated degradation of human papillomavirus 18 E6 mRNA: opposite effect of siRNA in combination with different drugs.
Authors:Koivusalo R, Krausz E, Helenius H, Hietanen S.
Journal:Mol Pharmacol. 2005 Aug;68(2):372-82. Epub 2005 May 20.
Entrez:15908516
siRNA sequence "gcacacacguagacauucg" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcacacacguagacauucg" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1768 " record
Length: 19
GC Content:53 %
Starting position: 773
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Length: 19
GC Content:53 %
Starting position: 773
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Offtargets for "gcacacacguagacauucg" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:16369495
Article:Short-term induction and long-term suppression of HPV16 oncogene silencing by RNA interference in cervical cancer cells.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:Oncogene. 2006 Mar 30;25(14):2094-104.
Entrez:16369495
Article:Short-term induction and long-term suppression of HPV16 oncogene silencing by RNA interference in cervical cancer cells.
Authors:Tang S, Tao M, McCoy JP Jr, Zheng ZM.
Journal:Oncogene. 2006 Mar 30;25(14):2094-104.
Entrez:16369495
siRNA sequence "cuucgguugugcguacaaagc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cuucgguugugcguacaaagc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1760 " record
Length: 21
GC Content:52 %
Starting position: 754
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:52 %
Starting position: 754
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cuucgguugugcguacaaagc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144
siRNA sequence "auagugaccuguugcugug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "auagugaccuguugcugug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1690 " record
Length: 19
GC Content:47 %
Starting position: 689
Strain of Virus: HPV6b
GenBank Acc: X00203
Transfection Reagent: Lipofectamine 2000
Length: 19
GC Content:47 %
Starting position: 689
Strain of Virus: HPV6b
GenBank Acc: X00203
Transfection Reagent: Lipofectamine 2000
Offtargets for "auagugaccuguugcugug" siRNA in Human Genome sequences
See X00203 at Genbank
Pubmed:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612
siRNA sequence "acaagacgcacaaccuuua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "acaagacgcacaaccuuua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1689 " record
Length: 19
GC Content:42 %
Starting position: 655
Strain of Virus: HPV11
GenBank Acc: FN907963
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 19
GC Content:42 %
Starting position: 655
Strain of Virus: HPV11
GenBank Acc: FN907963
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "acaagacgcacaaccuuua" siRNA in Human Genome sequences
See FN907963 at Genbank
Pubmed:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612
siRNA sequence "gcccauuacaauauuguaacc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcccauuacaauauuguaacc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1759 " record
Length: 21
GC Content:38 %
Starting position: 709
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:38 %
Starting position: 709
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gcccauuacaauauuguaacc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144
siRNA sequence "caccuacauugcaugaauaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "caccuacauugcaugaauaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1761 " record
Length: 21
GC Content:33 %
Starting position: 575
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:33 %
Starting position: 575
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "caccuacauugcaugaauaua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144
siRNA sequence "cucuacuguuaugagc" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cucuacuguuaugagc" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1739 " record
Length: 16
GC Content:44 %
Starting position: 625
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 16
GC Content:44 %
Starting position: 625
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "cucuacuguuaugagc" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
siRNA sequence "ccggacagagcccauuacaau" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "ccggacagagcccauuacaau" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1758 " record
Length: 21
GC Content:52 %
Starting position: 700
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:52 %
Starting position: 700
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ccggacagagcccauuacaau" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144
Article:New highly potent and specific E6 and E7 siRNAs for treatment of HPV16 positive cervical cancer.
Authors:Yamato K, Yamada T, Kizaki M, Ui-Tei K, Natori Y, Fujino M, Nishihara T, Ikeda Y, Nasu Y, Saigo K, Yoshinouchi M.
Journal:Cancer Gene Ther. 2008 Mar;15(3):140-53. Epub 2007 Dec 21.
Entrez:18157144
siRNA sequence "gcaauuaaaugacagcuca" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gcaauuaaaugacagcuca" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1748 " record
Length: 19
GC Content:37 %
Starting position: 639
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: siQUEST
Incubation Time (Hours):48
Length: 19
GC Content:37 %
Starting position: 639
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: siQUEST
Incubation Time (Hours):48
Offtargets for "gcaauuaaaugacagcuca" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18755502
Article:Gene silencing with siRNA targeting E6/E7 as a therapeutic intervention in a mouse model of cervical cancer.
Authors:Jonson AL, Rogers LM, Ramakrishnan S, Downs LS Jr.
Journal:Gynecol Oncol. 2008 Nov;111(2):356-64. Epub 2008 Aug 27.
Entrez:18755502
Article:Gene silencing with siRNA targeting E6/E7 as a therapeutic intervention in a mouse model of cervical cancer.
Authors:Jonson AL, Rogers LM, Ramakrishnan S, Downs LS Jr.
Journal:Gynecol Oncol. 2008 Nov;111(2):356-64. Epub 2008 Aug 27.
Entrez:18755502
siRNA sequence "uucuaugucacgagcaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "uucuaugucacgagcaa" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1742 " record
Length: 17
GC Content:41 %
Starting position: 663
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 17
GC Content:41 %
Starting position: 663
Strain of Virus: HPV18
GenBank Acc: NC_001357
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "uucuaugucacgagcaa" siRNA in Human Genome sequences
See NC_001357 at Genbank
Pubmed:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
Article:Highly potent and specific siRNAs against E6 or E7 genes of HPV16- or HPV18-infected cervical cancers.
Authors:Chang JT, Kuo TF, Chen YJ, Chiu CC, Lu YC, Li HF, Shen CR, Cheng AJ.
Journal:Cancer Gene Ther. 2010 Dec;17(12):827-36. Epub 2010 Oct 1.
Entrez:20885450
siRNA sequence "gacagagcccauuacaaua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gacagagcccauuacaaua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1750 " record
Length: 19
GC Content:42 %
Starting position: 703
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: siQUEST
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 703
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: siQUEST
Incubation Time (Hours):48
Offtargets for "gacagagcccauuacaaua" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:18755502
Article:Gene silencing with siRNA targeting E6/E7 as a therapeutic intervention in a mouse model of cervical cancer.
Authors:Jonson AL, Rogers LM, Ramakrishnan S, Downs LS Jr.
Journal:Gynecol Oncol. 2008 Nov;111(2):356-64. Epub 2008 Aug 27.
Entrez:18755502
Article:Gene silencing with siRNA targeting E6/E7 as a therapeutic intervention in a mouse model of cervical cancer.
Authors:Jonson AL, Rogers LM, Ramakrishnan S, Downs LS Jr.
Journal:Gynecol Oncol. 2008 Nov;111(2):356-64. Epub 2008 Aug 27.
Entrez:18755502
siRNA sequence "cgcgguucauaaagcuaaa" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "cgcgguucauaaagcuaaa" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1691 " record
Length: 19
GC Content:42 %
Starting position: 472
Strain of Virus: HPV6b
GenBank Acc: X00203
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 472
Strain of Virus: HPV6b
GenBank Acc: X00203
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cgcgguucauaaagcuaaa" siRNA in Human Genome sequences
See X00203 at Genbank
Pubmed:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612
siRNA sequence "agacaucuuagacgugcua" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "agacaucuuagacgugcua" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1692 " record
Length: 19
GC Content:42 %
Starting position: 386
Strain of Virus: HPV6b
GenBank Acc: X00203
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 386
Strain of Virus: HPV6b
GenBank Acc: X00203
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "agacaucuuagacgugcua" siRNA in Human Genome sequences
See X00203 at Genbank
Pubmed:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612
Article:Epigenetic silencing of interferon-kappa in human papillomavirus type 16-positive cells.
Authors:Rincon-Orozco B, Halec G, Rosenberger S, Muschik D, Nindl I, Bachmann A, Ritter TM, Dondog B, Ly R, Bosch FX, Zawatzky R, Rösl F.
Journal:Cancer Res. 2009 Nov 15;69(22):8718-25. Epub 2009 Nov 3.
Entrez:19887612
Virus_Name
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm