VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for PR are 4
Results from 0 - 25

siRNA sequence "aagcacuuuagugaccuggaa" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "aagcacuuuagugaccuggaa" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1846 " record
Length: 21
GC Content:43 %
Starting position: 136954
Strain of Virus: B95-8
GenBank Acc: NC_009334
Transfection Reagent: Jetsi-ENDO
Incubation Time (Hours):72

Offtargets for "aagcacuuuagugaccuggaa" siRNA in Human Genome sequences
See NC_009334 at Genbank
Pubmed:19704168
Article:Inhibition of Epstein-Barr virus replication by small interfering RNA targeting the Epstein-Barr virus protease gene.
Authors:Larrat S, Morand P, Bas A, Vigne S, Crance JM, Boyer V, Nicod S, Grossi L, Buisson M, Burmeister WP, Seigneurin JM, Germi R.
Journal:Antivir Ther. 2009;14(5):655-62.
Entrez:19704168

siRNA sequence "aaggccaucgaugcuggauuu" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "aaggccaucgaugcuggauuu" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1848 " record
Length: 21
GC Content:48 %
Starting position: 137074
Strain of Virus: B95-8
GenBank Acc: NC_009334
Transfection Reagent: Jetsi-ENDO
Incubation Time (Hours):72

Offtargets for "aaggccaucgaugcuggauuu" siRNA in Human Genome sequences
See NC_009334 at Genbank
Pubmed:19704168
Article:Inhibition of Epstein-Barr virus replication by small interfering RNA targeting the Epstein-Barr virus protease gene.
Authors:Larrat S, Morand P, Bas A, Vigne S, Crance JM, Boyer V, Nicod S, Grossi L, Buisson M, Burmeister WP, Seigneurin JM, Germi R.
Journal:Antivir Ther. 2009;14(5):655-62.
Entrez:19704168

siRNA sequence "aggcaagcuguccuucuuuga" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "aggcaagcuguccuucuuuga" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1845 " record
Length: 21
GC Content:48 %
Starting position: 136857
Strain of Virus: B95-8
GenBank Acc: NC_009334
Transfection Reagent: Jetsi-ENDO
Incubation Time (Hours):72

Offtargets for "aggcaagcuguccuucuuuga" siRNA in Human Genome sequences
See NC_009334 at Genbank
Pubmed:19704168
Article:Inhibition of Epstein-Barr virus replication by small interfering RNA targeting the Epstein-Barr virus protease gene.
Authors:Larrat S, Morand P, Bas A, Vigne S, Crance JM, Boyer V, Nicod S, Grossi L, Buisson M, Burmeister WP, Seigneurin JM, Germi R.
Journal:Antivir Ther. 2009;14(5):655-62.
Entrez:19704168

siRNA sequence "aaggcacuucagagcccacca" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "aaggcacuucagagcccacca" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1847 " record
Length: 21
GC Content:57 %
Starting position: 137200
Strain of Virus: B95-8
GenBank Acc: NC_009334
Transfection Reagent: Jetsi-ENDO
Incubation Time (Hours):72

Offtargets for "aaggcacuucagagcccacca" siRNA in Human Genome sequences
See NC_009334 at Genbank
Pubmed:19704168
Article:Inhibition of Epstein-Barr virus replication by small interfering RNA targeting the Epstein-Barr virus protease gene.
Authors:Larrat S, Morand P, Bas A, Vigne S, Crance JM, Boyer V, Nicod S, Grossi L, Buisson M, Burmeister WP, Seigneurin JM, Germi R.
Journal:Antivir Ther. 2009;14(5):655-62.
Entrez:19704168


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1846	aagcacuuuagugaccuggaa	Epstein-Barr Virus [EBV]	PR	293/EBV-GFP	mRNA	64	19704168	Blast SL	refseqs
virsi1848	aaggccaucgaugcuggauuu	Epstein-Barr Virus [EBV]	PR	293/EBV-GFP	mRNA	54	19704168	Blast SL	refseqs
virsi1845	aggcaagcuguccuucuuuga	Epstein-Barr Virus [EBV]	PR	293/EBV-GFP	mRNA	48	19704168	Blast SL	refseqs
virsi1847	aaggcacuucagagcccacca	Epstein-Barr Virus [EBV]	PR	293/EBV-GFP	mRNA	7	19704168	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm