VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for S are 87
Results from 0 - 25

« previous1234next »
siRNA sequence "auuccuaugggagugggcc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "auuccuaugggagugggcc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1959 " record
Length: 19
GC Content:58 %
Starting position: 636
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "auuccuaugggagugggcc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:20642484
Article:Knockdown of HBV surface antigen gene expression by a lentiviral microRNA-based system inhibits HBV replication and HCC growth.
Authors:Xiangji L, Feng X, Qingbao C, Weifeng T, Xiaoqing J, Baihe Z, Feng S, Hongyang W, Mengchao W.
Journal:J Viral Hepat. 2011 Sep;18(9):653-60. doi: 10.1111/j.1365-2893.2010.01346.x. Epub 2010 Jul 19.
Entrez:20642484

siRNA sequence "gaugugucugcggcguuuuau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaugugucugcggcguuuuau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1953 " record
Length: 21
GC Content:48 %
Starting position: 222
GenBank Acc: HQ641713
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "gaugugucugcggcguuuuau" siRNA in Human Genome sequences
See HQ641713 at Genbank
Pubmed:20696079
Article:RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.
Authors:Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.
Journal:BMC Microbiol. 2010 Aug 10;10:214.
Entrez:20696079

siRNA sequence "aaggcaacgcuauggcacucu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aaggcaacgcuauggcacucu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1414 " record
Length: 21
GC Content:52 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aaggcaacgcuauggcacucu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "aaauuuggagaguggcaggugg" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aaauuuggagaguggcaggugg" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1416 " record
Length: 22
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aaauuuggagaguggcaggugg" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "aaccuugcugcaguuagga" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aaccuugcugcaguuagga" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1417 " record
Length: 19
GC Content:47 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aaccuugcugcaguuagga" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1059 " record
Length: 19
GC Content:53 %
Starting position: 460
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):60

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See at Genbank
Pubmed:16153600
Article:Therapeutic inhibition of hepatitis B virus surface antigen expression by RNA interference.
Authors:Cheng TL, Chang WW, Su IJ, Lai MD, Huang W, Lei HY, Chang WT.
Journal:Biochem Biophys Res Commun. 2005 Oct 28;336(3):820-30.
Entrez:16153600

siRNA sequence "caaccaguacgggaccaug" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caaccaguacgggaccaug" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1060 " record
Length: 19
GC Content:58 %
Starting position: 500
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):60

Offtargets for "caaccaguacgggaccaug" siRNA in Human Genome sequences
See at Genbank
Pubmed:16153600
Article:Therapeutic inhibition of hepatitis B virus surface antigen expression by RNA interference.
Authors:Cheng TL, Chang WW, Su IJ, Lai MD, Huang W, Lei HY, Chang WT.
Journal:Biochem Biophys Res Commun. 2005 Oct 28;336(3):820-30.
Entrez:16153600

siRNA sequence "gccucaucuucuuauuggu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gccucaucuucuuauuggu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1061 " record
Length: 19
GC Content:42 %
Starting position: 425
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):60

Offtargets for "gccucaucuucuuauuggu" siRNA in Human Genome sequences
See at Genbank
Pubmed:16153600
Article:Therapeutic inhibition of hepatitis B virus surface antigen expression by RNA interference.
Authors:Cheng TL, Chang WW, Su IJ, Lai MD, Huang W, Lei HY, Chang WT.
Journal:Biochem Biophys Res Commun. 2005 Oct 28;336(3):820-30.
Entrez:16153600

siRNA sequence "ccuccaaucacucaccaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccuccaaucacucaccaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1062 " record
Length: 19
GC Content:53 %
Starting position: 326
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):60

Offtargets for "ccuccaaucacucaccaac" siRNA in Human Genome sequences
See at Genbank
Pubmed:16153600
Article:Therapeutic inhibition of hepatitis B virus surface antigen expression by RNA interference.
Authors:Cheng TL, Chang WW, Su IJ, Lai MD, Huang W, Lei HY, Chang WT.
Journal:Biochem Biophys Res Commun. 2005 Oct 28;336(3):820-30.
Entrez:16153600

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1160 " record
Length: 19
GC Content:53 %
GenBank Acc: JF271746
Transfection Reagent: Lipofectamine 2000

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See JF271746 at Genbank
Pubmed:15765406
Article:RNA interference-mediated control of hepatitis B virus and emergence of resistant mutant.
Authors:Wu HL, Huang LR, Huang CC, Lai HL, Liu CJ, Huang YT, Hsu YW, Lu CY, Chen DS, Chen PJ.
Journal:Gastroenterology. 2005 Mar;128(3):708-16.
Entrez:15765406

siRNA sequence "ccuccaaucacucaccaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccuccaaucacucaccaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi2009 " record
Length: 19
GC Content:53 %
Starting position: 324
Strain of Virus: ayr
GenBank Acc: X04615
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ccuccaaucacucaccaac" siRNA in Human Genome sequences
See X04615 at Genbank
Pubmed:15316660
Article:Genome-wide expression profiling of RNA interference of hepatitis B virus gene expression and replication.
Authors:Li Y, Wasser S, Lim SG, Tan TM.
Journal:Cell Mol Life Sci. 2004 Aug;61(16):2113-24.
Entrez:15316660

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1995 " record
Length: 19
GC Content:53 %
Starting position: 458
Strain of Virus: ayr
GenBank Acc: X04615
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See X04615 at Genbank
Pubmed:15316660
Article:Genome-wide expression profiling of RNA interference of hepatitis B virus gene expression and replication.
Authors:Li Y, Wasser S, Lim SG, Tan TM.
Journal:Cell Mol Life Sci. 2004 Aug;61(16):2113-24.
Entrez:15316660

siRNA sequence "aggcaguccucaacuauaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2288 " record
Length: 19
GC Content:42 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aggcaguccucaacuauaa" siRNA in Human Genome sequences
See DQ076419.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011

siRNA sequence "aagguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1144 " record
Length: 21
GC Content:48 %
Starting position: 458
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aagguauguugcccguuuguc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "aagucuguacagcaucuugag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagucuguacagcaucuugag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1145 " record
Length: 21
GC Content:43 %
Starting position: 765
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aagucuguacagcaucuugag" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "ggcuccucugccgauccauac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggcuccucugccgauccauac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1081 " record
Length: 21
GC Content:62 %
Transfection Reagent: Effectene
Incubation Time (Hours):120

Offtargets for "ggcuccucugccgauccauac" siRNA in Human Genome sequences
See at Genbank
Pubmed:16254373
Article:Genomic analysis of anti-hepatitis B virus (HBV) activity by small interfering RNA and lamivudine in stable HBV-producing cells.
Authors:Guo Y, Guo H, Zhang L, Xie H, Zhao X, Wang F, Li Z, Wang Y, Ma S, Tao J, Wang W, Zhou Y, Yang W, Cheng J.
Journal:J Virol. 2005 Nov;79(22):14392-403.
Entrez:16254373

siRNA sequence "aggcuguaggcauaaauuggu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aggcuguaggcauaaauuggu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1955 " record
Length: 21
GC Content:43 %
Starting position: 1734
GenBank Acc: FJ589068
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "aggcuguaggcauaaauuggu" siRNA in Human Genome sequences
See FJ589068 at Genbank
Pubmed:20696079
Article:RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.
Authors:Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.
Journal:BMC Microbiol. 2010 Aug 10;10:214.
Entrez:20696079

siRNA sequence "agauuguugccaguacuaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2287 " record
Length: 19
GC Content:37 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "agauuguugccaguacuaa" siRNA in Human Genome sequences
See DQ076419.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011

siRNA sequence "cgaugaugcgccaaagaga" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2289 " record
Length: 19
GC Content:53 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cgaugaugcgccaaagaga" siRNA in Human Genome sequences
See DQ076419.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011

siRNA sequence "aaccuccaaucacucaccaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaccuccaaucacucaccaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1149 " record
Length: 21
GC Content:48 %
Starting position: 324
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "aaccuccaaucacucaccaac" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16298967
Article:Inhibition of hepatitis B virus replication by various RNAi constructs and their pharmacodynamic properties.
Authors:Peng J, Zhao Y, Mai J, Pang WK, Wei X, Zhang P, Xu Y.
Journal:J Gen Virol. 2005 Dec;86(Pt 12):3227-34.
Entrez:16298967

siRNA sequence "gguauguugcccguuugucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuugucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1458 " record
Length: 20
GC Content:50 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gguauguugcccguuugucu" siRNA in Human Genome sequences
See at Genbank
Pubmed:16929350
Article:Long-term inhibition of hepatitis B virus in transgenic mice by double-stranded adeno-associated virus 8-delivered short hairpin RNA.
Authors:Chen CC, Ko TM, Ma HI, Wu HL, Xiao X, Li J, Chang CM, Wu PY, Chen CH, Han JM, Yu CP, Jeng KS, Hu CP, Tao MH.
Journal:Gene Ther. 2007 Jan;14(1):11-9. Epub 2006 Aug 24.
Entrez:16929350

siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1023 " record
Length: 19
GC Content:53 %
Starting position: 458
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934

siRNA sequence "gaauccucacaauaccgca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaauccucacaauaccgca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1006 " record
Length: 19
GC Content:47 %
Starting position: 225
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gaauccucacaauaccgca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18378325
Article:Inhibition of hepatitis B virus gene expression and replication by endoribonuclease-prepared siRNA.
Authors:Meng Z, Xu Y, Wu J, Tian Y, Kemper T, Bleekmann B, Roggendorf M, Yang D, Lu M.
Journal:J Virol Methods. 2008 Jun;150(1-2):27-33. Epub 2008 Apr 18.
Entrez:18378325

siRNA sequence "aagaauccucacaauaccgca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaauccucacaauaccgca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1143 " record
Length: 21
GC Content:43 %
Starting position: 225
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aagaauccucacaauaccgca" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "gcucccgcgugucuuggcc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcucccgcgugucuuggcc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1996 " record
Length: 19
GC Content:74 %
Starting position: 287
Strain of Virus: ayw
GenBank Acc: AB048705
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcucccgcgugucuuggcc" siRNA in Human Genome sequences
See AB048705 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1959	auuccuaugggagugggcc	Hepatitis B Virus [HBV]	S	293T	Protein	Low	20642484	Blast SL	refseqs
virsi1953	gaugugucugcggcguuuuau	Hepatitis B Virus [HBV]	S	Huh-7	mRNA	High	20696079	Blast SL	refseqs
virsi1414	aaggcaacgcuauggcacucu	La Crosse Virus	S	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1416	aaauuuggagaguggcaggugg	La Crosse Virus	S	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1417	aaccuugcugcaguuagga	La Crosse Virus	S	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1059	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	Huh-7	Protein	100	16153600	Blast SL	refseqs
virsi1060	caaccaguacgggaccaug	Hepatitis B Virus [HBV]	S	Huh-7	Protein	100	16153600	Blast SL	refseqs
virsi1061	gccucaucuucuuauuggu	Hepatitis B Virus [HBV]	S	Huh-7	Protein	100	16153600	Blast SL	refseqs
virsi1062	ccuccaaucacucaccaac	Hepatitis B Virus [HBV]	S	Huh-7	Protein	100	16153600	Blast SL	refseqs
virsi1160	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	Huh-7	Protein	98	15765406	Blast SL	refseqs
virsi2009	ccuccaaucacucaccaac	Hepatitis B Virus [HBV]	S	PLC/PRF/5	Protein	96	15316660	Blast SL	refseqs
virsi1995	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	PLC/PRF/5	Protein	96	15316660	Blast SL	refseqs
virsi2288	aggcaguccucaacuauaa	Hazara Nairovirus	S	A549	Viral Titer	92	21600011	Blast SL	refseqs
virsi1144	aagguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	HepG2	Protein	91	17334648	Blast SL	refseqs
virsi1145	aagucuguacagcaucuugag	Hepatitis B Virus [HBV]	S	HepG2	RNA	90	17334648	Blast SL	refseqs
virsi1081	ggcuccucugccgauccauac	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	88	16254373	Blast SL	refseqs
virsi1955	aggcuguaggcauaaauuggu	Hepatitis B Virus [HBV]	S	Huh-7	mRNA	88	20696079	Blast SL	refseqs
virsi2287	agauuguugccaguacuaa	Hazara Nairovirus	S	A549	Viral Titer	88	21600011	Blast SL	refseqs
virsi2289	cgaugaugcgccaaagaga	Hazara Nairovirus	S	A549	Viral Titer	86	21600011	Blast SL	refseqs
virsi1149	aaccuccaaucacucaccaac	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	85	16298967	Blast SL	refseqs
virsi1458	gguauguugcccguuugucu	Hepatitis B Virus [HBV]	S	HepG2	Protein	85	16929350	Blast SL	refseqs
virsi1023	gguauguugcccguuuguc	Hepatitis B Virus [HBV]	S	HepG2.2.15	mRNA	85	18274934	Blast SL	refseqs
virsi1006	gaauccucacaauaccgca	Hepatitis B Virus [HBV]	S	HepG2.2.15	Protein	83	18378325	Blast SL	refseqs
virsi1143	aagaauccucacaauaccgca	Hepatitis B Virus [HBV]	S	HepG2	RNA	83	17334648	Blast SL	refseqs
virsi1996	gcucccgcgugucuuggcc	Hepatitis B Virus [HBV]	S	HepG2.2.15	DNA	83	16022904	Blast SL	refseqs



« previous1234next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm