VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Herpesviridae are 79
Results from 0 - 25

« previous1234next »
siRNA sequence "gaauguaacucgaucugcu" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1909 " record
Length: 19
GC Content:42 %
Starting position: 60467
Strain of Virus: 6B
GenBank Acc: AB021506
Transfection Reagent: Oligofectamine

Offtargets for "gaauguaacucgaucugcu" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:15469723
Article:Inhibition of herpesvirus-6B RNA replication by short interference RNAs.
Authors:Yoon JS, Kim SH, Shin MC, Hong SK, Jung YT, Khang IG, Shin WS, Kim CC, Paik SY.
Journal:J Biochem Mol Biol. 2004 May 31;37(3):383-5.
Entrez:15469723

siRNA sequence "uguuuacgauucgaucga" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1910 " record
Length: 18
GC Content:39 %
Starting position: 60244
Strain of Virus: 6B
GenBank Acc: AB021506
Transfection Reagent: Oligofectamine

Offtargets for "uguuuacgauucgaucga" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:15469723
Article:Inhibition of herpesvirus-6B RNA replication by short interference RNAs.
Authors:Yoon JS, Kim SH, Shin MC, Hong SK, Jung YT, Khang IG, Shin WS, Kim CC, Paik SY.
Journal:J Biochem Mol Biol. 2004 May 31;37(3):383-5.
Entrez:15469723

siRNA sequence "gaauacgcuguguuuacau" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1912 " record
Length: 19
GC Content:37 %
Starting position: 83777
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48

Offtargets for "gaauacgcuguguuuacau" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767

siRNA sequence "auagcgcaucugccgaaag" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1913 " record
Length: 19
GC Content:53 %
Starting position: 84287
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48

Offtargets for "auagcgcaucugccgaaag" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767

siRNA sequence "acguccaaguugcauuggc" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "acguccaaguugcauuggc" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1853 " record
Length: 19
GC Content:53 %
Starting position: 108174
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "acguccaaguugcauuggc" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:16343579
Article:siRNAs against the Epstein Barr virus latency replication factor, EBNA1, inhibit its function and growth of EBV-dependent tumor cells.
Authors:Yin Q, Flemington EK.
Journal:Virology. 2006 Mar 15;346(2):385-93. Epub 2005 Dec 15.
Entrez:16343579

siRNA sequence "ggagguuccaacccgaaau" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ggagguuccaacccgaaau" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1854 " record
Length: 19
GC Content:53 %
Starting position: 109363
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ggagguuccaacccgaaau" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:16343579
Article:siRNAs against the Epstein Barr virus latency replication factor, EBNA1, inhibit its function and growth of EBV-dependent tumor cells.
Authors:Yin Q, Flemington EK.
Journal:Virology. 2006 Mar 15;346(2):385-93. Epub 2005 Dec 15.
Entrez:16343579

siRNA sequence "ggacuaccgacgaaggaac" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ggacuaccgacgaaggaac" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1855 " record
Length: 19
GC Content:58 %
Starting position: 109436
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ggacuaccgacgaaggaac" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:16343579
Article:siRNAs against the Epstein Barr virus latency replication factor, EBNA1, inhibit its function and growth of EBV-dependent tumor cells.
Authors:Yin Q, Flemington EK.
Journal:Virology. 2006 Mar 15;346(2):385-93. Epub 2005 Dec 15.
Entrez:16343579

siRNA sequence "uuggaauugauugcgaaag" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1907 " record
Length: 19
GC Content:37 %
Starting position: 60324
Strain of Virus: HSV-2
GenBank Acc: NC_001798
Transfection Reagent: siQUEST
Incubation Time (Hours):24

Offtargets for "uuggaauugauugcgaaag" siRNA in Human Genome sequences
See NC_001798 at Genbank
Pubmed:19154990
Article:Durable protection from Herpes Simplex Virus-2 transmission following intravaginal application of siRNAs targeting both a viral and host gene.
Authors:Wu Y, Navarro F, Lal A, Basar E, Pandey RK, Manoharan M, Feng Y, Lee SJ, Lieberman J, Palliser D.
Journal:Cell Host Microbe. 2009 Jan 22;5(1):84-94.
Entrez:19154990

siRNA sequence "aacugguggacucuauugg" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "aacugguggacucuauugg" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1857 " record
Length: 19
GC Content:47 %
Starting position: 1044
GenBank Acc: EU910136
Transfection Reagent: Oligofectamine

Offtargets for "aacugguggacucuauugg" siRNA in Human Genome sequences
See EU910136 at Genbank
Pubmed:15013447
Article:Suppression of Epstein-Barr virus-encoded latent membrane protein-1 by RNA interference inhibits the metastatic potential of nasopharyngeal carcinoma cells.
Authors:Li XP, Li G, Peng Y, Kung HF, Lin MC.
Journal:Biochem Biophys Res Commun. 2004 Feb 27;315(1):212-8.
Entrez:15013447

siRNA sequence "caacagcuagcagacauug" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "caacagcuagcagacauug" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1859 " record
Length: 19
GC Content:47 %
Starting position: 415
GenBank Acc: EU340368
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caacagcuagcagacauug" siRNA in Human Genome sequences
See EU340368 at Genbank
Pubmed:15166418
Article:Inhibition of the Epstein-Barr virus lytic cycle by Zta-targeted RNA interference.
Authors:Chang Y, Chang SS, Lee HH, Doong SL, Takada K, Tsai CH.
Journal:J Gen Virol. 2004 Jun;85(Pt 6):1371-9.
Entrez:15166418

siRNA sequence "ggaauuugcacggacaggc" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ggaauuugcacggacaggc" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1856 " record
Length: 19
GC Content:58 %
Starting position: 773
GenBank Acc: EU910134
Transfection Reagent: Lipofectamine 2000

Offtargets for "ggaauuugcacggacaggc" siRNA in Human Genome sequences
See EU910134 at Genbank
Pubmed:16458115
Article:siRNA targeting LMP1-induced apoptosis in EBV-positive lymphoma cells is associated with inhibition of telomerase activity and expression.
Authors:Mei YP, Zhu XF, Zhou JM, Huang H, Deng R, Zeng YX.
Journal:Cancer Lett. 2006 Feb 8;232(2):189-98.
Entrez:16458115

siRNA sequence "gccuguccgugcaaauucc" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "gccuguccgugcaaauucc" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1885 " record
Length: 19
GC Content:58 %
Starting position: 371
Strain of Virus: EBV
GenBank Acc: EU000388
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gccuguccgugcaaauucc" siRNA in Human Genome sequences
See EU000388 at Genbank
Pubmed:20338061
Article:Epstein-Barr virus encoded latent membrane protein 1 regulates mTOR signaling pathway genes which predict poor prognosis of nasopharyngeal carcinoma.
Authors:Chen J, Hu CF, Hou JH, Shao Q, Yan LX, Zhu XF, Zeng YX, Shao JY.
Journal:J Transl Med. 2010 Mar 26;8:30.
Entrez:20338061

siRNA sequence "ccucuccucuuccauaggc" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ccucuccucuuccauaggc" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1860 " record
Length: 19
GC Content:58 %
Starting position: 612
GenBank Acc: X66863
Incubation Time (Hours):60

Offtargets for "ccucuccucuuccauaggc" siRNA in Human Genome sequences
See X66863 at Genbank
Pubmed:16865275
Article:Recombinant adeno-associated virus mediated RNA interference inhibits metastasis of nasopharyngeal cancer cells in vivo and in vitro by suppression of Epstein-Barr virus encoded LMP-1.
Authors:Li X, Liu X, Li CY, Ding Y, Chau D, Li G, Kung HF, Lin MC, Peng Y.
Journal:Int J Oncol. 2006 Sep;29(3):595-603.
Entrez:16865275

siRNA sequence "guggacagagaaggucucu" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "guggacagagaaggucucu" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1850 " record
Length: 19
GC Content:53 %
Starting position: 622
GenBank Acc: EU910136
Transfection Reagent: Oligofectamine
Incubation Time (Hours):36

Offtargets for "guggacagagaaggucucu" siRNA in Human Genome sequences
See EU910136 at Genbank
Pubmed:15041532
Article:Effect of inhibition of EBV-encoded latent membrane protein-1 by small interfering RNA on EBV-positive nasopharyngeal carcinoma cell growth.
Authors:Li G, Li XP, Peng Y, Liu X, Li XH.
Journal:Di Yi Jun Yi Da Xue Xue Bao. 2004 Mar;24(3):241-6.
Entrez:15041532

siRNA sequence "ggacggagauuacacaguuua" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1889 " record
Length: 21
GC Content:43 %
Starting position: 139052
Strain of Virus: HSV-1 Strain 17
GenBank Acc: NC_001806
Transfection Reagent: Lipofectin
Incubation Time (Hours):48

Offtargets for "ggacggagauuacacaguuua" siRNA in Human Genome sequences
See NC_001806 at Genbank
Pubmed:18664330
Article:Short hairpin RNA-mediated inhibition of HSV-1 gene expression and function during HSV-1 infection in Vero cells.
Authors:Liu YY, Deng HY, Yang G, Jiang WL, Grossin L, Yang ZQ.
Journal:Acta Pharmacol Sin. 2008 Aug;29(8):975-82.
Entrez:18664330

siRNA sequence "ggaacuacuaugacagcuuca" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1888 " record
Length: 21
GC Content:43 %
Starting position: 138897
Strain of Virus: HSV-1 Strain 17
GenBank Acc: NC_001806
Transfection Reagent: Lipofectin
Incubation Time (Hours):48

Offtargets for "ggaacuacuaugacagcuuca" siRNA in Human Genome sequences
See NC_001806 at Genbank
Pubmed:18664330
Article:Short hairpin RNA-mediated inhibition of HSV-1 gene expression and function during HSV-1 infection in Vero cells.
Authors:Liu YY, Deng HY, Yang G, Jiang WL, Grossin L, Yang ZQ.
Journal:Acta Pharmacol Sin. 2008 Aug;29(8):975-82.
Entrez:18664330

siRNA sequence "uugccuucgaccuuuacgu" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1917 " record
Length: 19
GC Content:47 %
Starting position: 132182
Strain of Virus: HHV-8
GenBank Acc: AF148805
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "uugccuucgaccuuuacgu" siRNA in Human Genome sequences
See AF148805 at Genbank
Pubmed:19129458
Article:A systems biology approach to identify the combination effects of human herpesvirus 8 genes on NF-kappaB activation.
Authors:Konrad A, Wies E, Thurau M, Marquardt G, Naschberger E, Hentschel S, Jochmann R, Schulz TF, Erfle H, Brors B, Lausen B, Neipel F, Strzl M.
Journal:J Virol. 2009 Mar;83(6):2563-74. Epub 2009 Jan 7.
Entrez:19129458

siRNA sequence "guaagaccucccuuuacaaccuaag" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "guaagaccucccuuuacaaccuaag" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1873 " record
Length: 25
GC Content:44 %
Starting position: 109487
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "guaagaccucccuuuacaaccuaag" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888

siRNA sequence "gcaucguggucaaggagguuccaac" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "gcaucguggucaaggagguuccaac" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1871 " record
Length: 25
GC Content:56 %
Starting position: 109350
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gcaucguggucaaggagguuccaac" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888

siRNA sequence "atcggtgtgtatgctaaag" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1915 " record
Length: 19
GC Content:42 %
Starting position: 1390
Strain of Virus: HHV-6
GenBank Acc: Z18287
Incubation Time (Hours):48

Offtargets for "atcggtgtgtatgctaaag" siRNA in Human Genome sequences
See Z18287 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767

siRNA sequence "gtgaaacgatgtgttataa" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1916 " record
Length: 19
GC Content:32 %
Starting position: 2087
Strain of Virus: HHV-6
GenBank Acc: Z18287
Incubation Time (Hours):48

Offtargets for "gtgaaacgatgtgttataa" siRNA in Human Genome sequences
See Z18287 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767

siRNA sequence "uuaauagacaaugaccaca" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1898 " record
Length: 19
GC Content:32 %
Starting position: 12604
Strain of Virus: HSV-2
GenBank Acc: NC_001798
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):24

Offtargets for "uuaauagacaaugaccaca" siRNA in Human Genome sequences
See NC_001798 at Genbank
Pubmed:16306938
Article:An siRNA-based microbicide protects mice from lethal herpes simplex virus 2 infection.
Authors:Palliser D, Chowdhury D, Wang QY, Lee SJ, Bronson RT, Knipe DM, Lieberman J.
Journal:Nature. 2006 Jan 5;439(7072):89-94. Epub 2005 Nov 23.
Entrez:16306938

siRNA sequence "aucaacaccauaaaguacc" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1891 " record
Length: 19
GC Content:37 %
Starting position: 1838
Strain of Virus: HSV-1
GenBank Acc: K03350
Transfection Reagent: Lipofectin
Incubation Time (Hours):48

Offtargets for "aucaacaccauaaaguacc" siRNA in Human Genome sequences
See K03350 at Genbank
Pubmed:17979991
Article:Inhibition of herpes simplex virus type 1 by small interfering RNA.
Authors:Zhang YQ, Lai W, Li H, Li G.
Journal:Clin Exp Dermatol. 2008 Jan;33(1):56-61. Epub 2007 Nov 2.
Entrez:17979991

siRNA sequence "uuggaauugauugcgaaag" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1902 " record
Length: 19
GC Content:37 %
Starting position: 60324
Strain of Virus: HSV-2
GenBank Acc: NC_001798
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):24

Offtargets for "uuggaauugauugcgaaag" siRNA in Human Genome sequences
See NC_001798 at Genbank
Pubmed:16306938
Article:An siRNA-based microbicide protects mice from lethal herpes simplex virus 2 infection.
Authors:Palliser D, Chowdhury D, Wang QY, Lee SJ, Bronson RT, Knipe DM, Lieberman J.
Journal:Nature. 2006 Jan 5;439(7072):89-94. Epub 2005 Nov 23.
Entrez:16306938

siRNA sequence "gucggucgagaauacgcugug" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1911 " record
Length: 21
GC Content:57 %
Starting position: 83768
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48

Offtargets for "gucggucgagaauacgcugug" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1909	gaauguaacucgaucugcu	Herpes Simplex Virus [HSV]	UL38	SupT1	Protein	Medium	15469723	Blast SL	refseqs
virsi1910	uguuuacgauucgaucga	Herpes Simplex Virus [HSV]	UL38	SupT1	Protein	Medium	15469723	Blast SL	refseqs
virsi1912	gaauacgcuguguuuacau	Herpes Simplex Virus [HSV]	U51	SupT1	Protein	Medium	16140767	Blast SL	refseqs
virsi1913	auagcgcaucugccgaaag	Herpes Simplex Virus [HSV]	U51	SupT1	Protein	Medium	16140767	Blast SL	refseqs
virsi1853	acguccaaguugcauuggc	Epstein-Barr Virus [EBV]	EBNA1	HeLa	Protein	High	16343579	Blast SL	refseqs
virsi1854	ggagguuccaacccgaaau	Epstein-Barr Virus [EBV]	EBNA1	HeLa	Protein	High	16343579	Blast SL	refseqs
virsi1855	ggacuaccgacgaaggaac	Epstein-Barr Virus [EBV]	EBNA1	HeLa	Protein	High	16343579	Blast SL	refseqs
virsi1907	uuggaauugauugcgaaag	Herpes Simplex Virus [HSV]	UL29	NIH 3T3	Plaque Count	High	19154990	Blast SL	refseqs
virsi1857	aacugguggacucuauugg	Epstein-Barr Virus [EBV]	LMP1	C666	mRNA	High	15013447	Blast SL	refseqs
virsi1859	caacagcuagcagacauug	Epstein-Barr Virus [EBV]	Zta	NPC	Protein	High	15166418	Blast SL	refseqs
virsi1856	ggaauuugcacggacaggc	Epstein-Barr Virus [EBV]	LMP1	B95.8	Protein	High	16458115	Blast SL	refseqs
virsi1885	gccuguccgugcaaauucc	Epstein-Barr Virus [EBV]	LMP1	C666-1	Protein	High	20338061	Blast SL	refseqs
virsi1860	ccucuccucuuccauaggc	Epstein-Barr Virus [EBV]	LMP1	C666-1	RNA	High	16865275	Blast SL	refseqs
virsi1850	guggacagagaaggucucu	Epstein-Barr Virus [EBV]	LMP1	C666-1	mRNA	High	15041532	Blast SL	refseqs
virsi1889	ggacggagauuacacaguuua	Herpes Simplex Virus [HSV]	gD	Vero, Strain 186	Viral Load	97	18664330	Blast SL	refseqs
virsi1888	ggaacuacuaugacagcuuca	Herpes Simplex Virus [HSV]	gD	Vero, Strain 186	Viral Load	96	18664330	Blast SL	refseqs
virsi1917	uugccuucgaccuuuacgu	Herpes Simplex Virus [HSV]	ORF75	HEK 293T	mRNA	95	19129458	Blast SL	refseqs
virsi1873	guaagaccucccuuuacaaccuaag	Epstein-Barr Virus [EBV]	EBNA1	HeLa	mRNA	94	19471888	Blast SL	refseqs
virsi1871	gcaucguggucaaggagguuccaac	Epstein-Barr Virus [EBV]	EBNA1	HeLa	mRNA	90	19471888	Blast SL	refseqs
virsi1915	atcggtgtgtatgctaaag	Herpes Simplex Virus [HSV]	gB	SupT1	Protein	90	16140767	Blast SL	refseqs
virsi1916	gtgaaacgatgtgttataa	Herpes Simplex Virus [HSV]	gB	SupT1	Protein	90	16140767	Blast SL	refseqs
virsi1898	uuaauagacaaugaccaca	Herpes Simplex Virus [HSV]	UL5	Vero	mRNA	88	16306938	Blast SL	refseqs
virsi1891	aucaacaccauaaaguacc	Herpes Simplex Virus [HSV]	Vp 16	Vero	Cell Count	85	17979991	Blast SL	refseqs
virsi1902	uuggaauugauugcgaaag	Herpes Simplex Virus [HSV]	UL29	Vero	mRNA	82	16306938	Blast SL	refseqs
virsi1911	gucggucgagaauacgcugug	Herpes Simplex Virus [HSV]	U51	SupT1	Protein	80	16140767	Blast SL	refseqs



« previous1234next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm