Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for Bunyaviridae are 27
Results from 0 - 25
siRNA sequence "aagucuuuagggucuucuaccu" alignment with "John Cunningham Virus [JCV]" virus reference Genome sequences
siRNA sequence matching with "aagucuuuagggucuucuaccu" John Cunningham Virus [JCV]" Virus reference Genome sequences
Browse all the records for "John Cunningham Virus [JCV]" virus
Browse "virsi2016 " record
Length: 22
GC Content:41 %
Starting position: 4256
Strain of Virus: Mad-1
GenBank Acc: NC_001699
Length: 22
GC Content:41 %
Starting position: 4256
Strain of Virus: Mad-1
GenBank Acc: NC_001699
Offtargets for "aagucuuuagggucuucuaccu" siRNA in Human Genome sequences
See NC_001699 at Genbank
Pubmed:15194802
Article:Intracellular approach for blocking JC virus gene expression by using RNA interference during viral infection.
Authors:Radhakrishnan S, Gordon J, Del Valle L, Cui J, Khalili K.
Journal:J Virol. 2004 Jul;78(13):7264-9.
Entrez:15194802
Article:Intracellular approach for blocking JC virus gene expression by using RNA interference during viral infection.
Authors:Radhakrishnan S, Gordon J, Del Valle L, Cui J, Khalili K.
Journal:J Virol. 2004 Jul;78(13):7264-9.
Entrez:15194802
siRNA sequence "uuuccuggcuaguggauuu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "uuuccuggcuaguggauuu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1424 " record
Length: 19
GC Content:42 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 19
GC Content:42 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "uuuccuggcuaguggauuu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "aaggcaacgcuauggcacucu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aaggcaacgcuauggcacucu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1414 " record
Length: 21
GC Content:52 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 21
GC Content:52 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "aaggcaacgcuauggcacucu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "aaauuuggagaguggcaggugg" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aaauuuggagaguggcaggugg" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1416 " record
Length: 22
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 22
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "aaauuuggagaguggcaggugg" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "aaccuugcugcaguuagga" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aaccuugcugcaguuagga" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1417 " record
Length: 19
GC Content:47 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 19
GC Content:47 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "aaccuugcugcaguuagga" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "aacuugccgcacaucaaacc" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aacuugccgcacaucaaacc" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1418 " record
Length: 20
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 20
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "aacuugccgcacaucaaacc" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "aauuuccguacuagauguccc" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aauuuccguacuagauguccc" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1419 " record
Length: 21
GC Content:43 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 21
GC Content:43 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "aauuuccguacuagauguccc" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "uuacugcgguacuggucuu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "uuacugcgguacuggucuu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1420 " record
Length: 19
GC Content:47 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 19
GC Content:47 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "uuacugcgguacuggucuu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "agaugauauugcgggugcuu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "agaugauauugcgggugcuu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1421 " record
Length: 20
GC Content:45 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 20
GC Content:45 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "agaugauauugcgggugcuu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "ucaaacuugcgaacaccuu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "ucaaacuugcgaacaccuu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1422 " record
Length: 19
GC Content:42 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 19
GC Content:42 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "ucaaacuugcgaacaccuu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "auauguuugcagcgcagauu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "auauguuugcagcgcagauu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1423 " record
Length: 20
GC Content:40 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 20
GC Content:40 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "auauguuugcagcgcagauu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "aauggcuagucucugauug" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aauggcuagucucugauug" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1425 " record
Length: 19
GC Content:42 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 19
GC Content:42 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "aauggcuagucucugauug" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "aauauacgggaguccucaacg" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aauauacgggaguccucaacg" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1426 " record
Length: 21
GC Content:48 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 21
GC Content:48 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "aauauacgggaguccucaacg" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "agccagcacgcuacaugauu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "agccagcacgcuacaugauu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1427 " record
Length: 20
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 20
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "agccagcacgcuacaugauu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "aagacacaaccacuugcgga" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aagacacaaccacuugcgga" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1429 " record
Length: 20
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Length: 20
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48
Offtargets for "aagacacaaccacuugcgga" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819
siRNA sequence "aggcaguccucaacuauaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2288 " record
Length: 19
GC Content:42 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "aggcaguccucaacuauaa" siRNA in Human Genome sequences
See DQ076419.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
siRNA sequence "agauuguugccaguacuaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2287 " record
Length: 19
GC Content:37 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:37 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "agauuguugccaguacuaa" siRNA in Human Genome sequences
See DQ076419.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
siRNA sequence "cgaugaugcgccaaagaga" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2289 " record
Length: 19
GC Content:53 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:53 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cgaugaugcgccaaagaga" siRNA in Human Genome sequences
See DQ076419.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
siRNA sequence "cgagcauaaggguacaaua" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2292 " record
Length: 19
GC Content:42 %
GenBank Acc: DQ813514.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
GenBank Acc: DQ813514.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cgagcauaaggguacaaua" siRNA in Human Genome sequences
See DQ813514.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
siRNA sequence "cagucaugauggugguuua" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2291 " record
Length: 19
GC Content:42 %
GenBank Acc: DQ813514.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
GenBank Acc: DQ813514.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cagucaugauggugguuua" siRNA in Human Genome sequences
See DQ813514.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
siRNA sequence "cgaggauaauauuggcaaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2295 " record
Length: 19
GC Content:37 %
GenBank Acc: M86624.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:37 %
GenBank Acc: M86624.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cgaggauaauauuggcaaa" siRNA in Human Genome sequences
See M86624.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
siRNA sequence "gaugaaaguugcuccuaua" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2293 " record
Length: 19
GC Content:37 %
GenBank Acc: DQ813514.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:37 %
GenBank Acc: DQ813514.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gaugaaaguugcuccuaua" siRNA in Human Genome sequences
See DQ813514.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
siRNA sequence "caaagaccaagucgaccaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2290 " record
Length: 19
GC Content:47 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:47 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "caaagaccaagucgaccaa" siRNA in Human Genome sequences
See DQ076419.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
siRNA sequence "caaauacuuugucaccaaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2294 " record
Length: 19
GC Content:32 %
GenBank Acc: DQ813514.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:32 %
GenBank Acc: DQ813514.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "caaauacuuugucaccaaa" siRNA in Human Genome sequences
See DQ813514.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
siRNA sequence "cgaggauaauauuggcaaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2296 " record
Length: 19
GC Content:37 %
GenBank Acc: M86624.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:37 %
GenBank Acc: M86624.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cgaggauaauauuggcaaa" siRNA in Human Genome sequences
See M86624.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi2016 | aagucuuuagggucuucuaccu | John Cunningham Virus [JCV] |  SL | refseqs |  | |||||
| virsi1424 | uuuccuggcuaguggauuu | La Crosse Virus | SL | refseqs |  | |||||
| virsi1414 | aaggcaacgcuauggcacucu | La Crosse Virus | SL | refseqs |  | |||||
| virsi1416 | aaauuuggagaguggcaggugg | La Crosse Virus | SL | refseqs |  | |||||
| virsi1417 | aaccuugcugcaguuagga | La Crosse Virus | SL | refseqs |  | |||||
| virsi1418 | aacuugccgcacaucaaacc | La Crosse Virus | SL | refseqs |  | |||||
| virsi1419 | aauuuccguacuagauguccc | La Crosse Virus | SL | refseqs |  | |||||
| virsi1420 | uuacugcgguacuggucuu | La Crosse Virus | SL | refseqs |  | |||||
| virsi1421 | agaugauauugcgggugcuu | La Crosse Virus | SL | refseqs |  | |||||
| virsi1422 | ucaaacuugcgaacaccuu | La Crosse Virus | SL | refseqs |  | |||||
| virsi1423 | auauguuugcagcgcagauu | La Crosse Virus | SL | refseqs |  | |||||
| virsi1425 | aauggcuagucucugauug | La Crosse Virus | SL | refseqs |  | |||||
| virsi1426 | aauauacgggaguccucaacg | La Crosse Virus | SL | refseqs |  | |||||
| virsi1427 | agccagcacgcuacaugauu | La Crosse Virus | SL | refseqs |  | |||||
| virsi1429 | aagacacaaccacuugcgga | La Crosse Virus | SL | refseqs |  | |||||
| virsi2288 | aggcaguccucaacuauaa | Hazara Nairovirus | SL | refseqs |  | |||||
| virsi2287 | agauuguugccaguacuaa | Hazara Nairovirus | SL | refseqs |  | |||||
| virsi2289 | cgaugaugcgccaaagaga | Hazara Nairovirus | SL | refseqs |  | |||||
| virsi2292 | cgagcauaaggguacaaua | Hazara Nairovirus | SL | refseqs |  | |||||
| virsi2291 | cagucaugauggugguuua | Hazara Nairovirus | SL | refseqs |  | |||||
| virsi2295 | cgaggauaauauuggcaaa | Hazara Nairovirus |  SL | refseqs |  | |||||
| virsi2293 | gaugaaaguugcuccuaua | Hazara Nairovirus | SL | refseqs |  | |||||
| virsi2290 | caaagaccaagucgaccaa | Hazara Nairovirus | SL | refseqs |  | |||||
| virsi2294 | caaauacuuugucaccaaa | Hazara Nairovirus | SL | refseqs |  | |||||
| virsi2296 | cgaggauaauauuggcaaa | Hazara Nairovirus | SL | refseqs |  |
: siRNA specific for both strands: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm