VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Bunyaviridae are 27
Results from 0 - 25

« previous12next »
siRNA sequence "aagucuuuagggucuucuaccu" alignment with "John Cunningham Virus [JCV]" virus reference Genome sequences
siRNA sequence matching with "aagucuuuagggucuucuaccu" John Cunningham Virus [JCV]" Virus reference Genome sequences
Browse all the records for "John Cunningham Virus [JCV]" virus
Browse "virsi2016 " record
Length: 22
GC Content:41 %
Starting position: 4256
Strain of Virus: Mad-1
GenBank Acc: NC_001699

Offtargets for "aagucuuuagggucuucuaccu" siRNA in Human Genome sequences
See NC_001699 at Genbank
Pubmed:15194802
Article:Intracellular approach for blocking JC virus gene expression by using RNA interference during viral infection.
Authors:Radhakrishnan S, Gordon J, Del Valle L, Cui J, Khalili K.
Journal:J Virol. 2004 Jul;78(13):7264-9.
Entrez:15194802

siRNA sequence "uuuccuggcuaguggauuu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "uuuccuggcuaguggauuu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1424 " record
Length: 19
GC Content:42 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "uuuccuggcuaguggauuu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "aaggcaacgcuauggcacucu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aaggcaacgcuauggcacucu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1414 " record
Length: 21
GC Content:52 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aaggcaacgcuauggcacucu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "aaauuuggagaguggcaggugg" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aaauuuggagaguggcaggugg" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1416 " record
Length: 22
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aaauuuggagaguggcaggugg" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "aaccuugcugcaguuagga" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aaccuugcugcaguuagga" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1417 " record
Length: 19
GC Content:47 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aaccuugcugcaguuagga" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "aacuugccgcacaucaaacc" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aacuugccgcacaucaaacc" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1418 " record
Length: 20
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aacuugccgcacaucaaacc" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "aauuuccguacuagauguccc" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aauuuccguacuagauguccc" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1419 " record
Length: 21
GC Content:43 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aauuuccguacuagauguccc" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "uuacugcgguacuggucuu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "uuacugcgguacuggucuu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1420 " record
Length: 19
GC Content:47 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "uuacugcgguacuggucuu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "agaugauauugcgggugcuu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "agaugauauugcgggugcuu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1421 " record
Length: 20
GC Content:45 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "agaugauauugcgggugcuu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "ucaaacuugcgaacaccuu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "ucaaacuugcgaacaccuu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1422 " record
Length: 19
GC Content:42 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "ucaaacuugcgaacaccuu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "auauguuugcagcgcagauu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "auauguuugcagcgcagauu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1423 " record
Length: 20
GC Content:40 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "auauguuugcagcgcagauu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "aauggcuagucucugauug" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aauggcuagucucugauug" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1425 " record
Length: 19
GC Content:42 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aauggcuagucucugauug" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "aauauacgggaguccucaacg" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aauauacgggaguccucaacg" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1426 " record
Length: 21
GC Content:48 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aauauacgggaguccucaacg" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "agccagcacgcuacaugauu" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "agccagcacgcuacaugauu" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1427 " record
Length: 20
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "agccagcacgcuacaugauu" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "aagacacaaccacuugcgga" alignment with "La Crosse Virus" virus reference Genome sequences
siRNA sequence matching with "aagacacaaccacuugcgga" La Crosse Virus" Virus reference Genome sequences
Browse all the records for "La Crosse Virus" virus
Browse "virsi1429 " record
Length: 20
GC Content:50 %
GenBank Acc: NC_004110
Transfection Reagent: siPORT
Incubation Time (Hours):48

Offtargets for "aagacacaaccacuugcgga" siRNA in Human Genome sequences
See NC_004110 at Genbank
Pubmed:15596819
Article:La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA.
Authors:Soldan SS, Plassmeyer ML, Matukonis MK, González-Scarano F.
Journal:J Virol. 2005 Jan;79(1):234-44.
Entrez:15596819

siRNA sequence "aggcaguccucaacuauaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2288 " record
Length: 19
GC Content:42 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aggcaguccucaacuauaa" siRNA in Human Genome sequences
See DQ076419.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011

siRNA sequence "agauuguugccaguacuaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2287 " record
Length: 19
GC Content:37 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "agauuguugccaguacuaa" siRNA in Human Genome sequences
See DQ076419.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011

siRNA sequence "cgaugaugcgccaaagaga" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2289 " record
Length: 19
GC Content:53 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cgaugaugcgccaaagaga" siRNA in Human Genome sequences
See DQ076419.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011

siRNA sequence "cgagcauaaggguacaaua" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2292 " record
Length: 19
GC Content:42 %
GenBank Acc: DQ813514.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cgagcauaaggguacaaua" siRNA in Human Genome sequences
See DQ813514.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011

siRNA sequence "cagucaugauggugguuua" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2291 " record
Length: 19
GC Content:42 %
GenBank Acc: DQ813514.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cagucaugauggugguuua" siRNA in Human Genome sequences
See DQ813514.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011

siRNA sequence "cgaggauaauauuggcaaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2295 " record
Length: 19
GC Content:37 %
GenBank Acc: M86624.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cgaggauaauauuggcaaa" siRNA in Human Genome sequences
See M86624.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011

siRNA sequence "gaugaaaguugcuccuaua" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2293 " record
Length: 19
GC Content:37 %
GenBank Acc: DQ813514.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gaugaaaguugcuccuaua" siRNA in Human Genome sequences
See DQ813514.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011

siRNA sequence "caaagaccaagucgaccaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2290 " record
Length: 19
GC Content:47 %
GenBank Acc: DQ076419.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caaagaccaagucgaccaa" siRNA in Human Genome sequences
See DQ076419.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011

siRNA sequence "caaauacuuugucaccaaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2294 " record
Length: 19
GC Content:32 %
GenBank Acc: DQ813514.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caaauacuuugucaccaaa" siRNA in Human Genome sequences
See DQ813514.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011

siRNA sequence "cgaggauaauauuggcaaa" alignment with "Hazara Nairovirus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hazara Nairovirus" virus
Browse "virsi2296 " record
Length: 19
GC Content:37 %
GenBank Acc: M86624.1
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cgaggauaauauuggcaaa" siRNA in Human Genome sequences
See M86624.1 at Genbank
Pubmed:21600011
Article:Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin.
Authors:Flusin O, Vigne S, Peyrefitte CN, Bouloy M, Crance JM, Iseni F.
Journal:Virol J. 2011 May 21;8:249.
Entrez:21600011


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi2016	aagucuuuagggucuucuaccu	John Cunningham Virus [JCV]	T-Ag	Human Primary Fetal Astrocytes	Protein	Medium	15194802	Blast SL	refseqs
virsi1424	uuuccuggcuaguggauuu	La Crosse Virus	L	293T	Viral Titer	Low	15596819	Blast SL	refseqs
virsi1414	aaggcaacgcuauggcacucu	La Crosse Virus	S	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1416	aaauuuggagaguggcaggugg	La Crosse Virus	S	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1417	aaccuugcugcaguuagga	La Crosse Virus	S	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1418	aacuugccgcacaucaaacc	La Crosse Virus	M (G2)	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1419	aauuuccguacuagauguccc	La Crosse Virus	M (G2)	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1420	uuacugcgguacuggucuu	La Crosse Virus	M (G2)	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1421	agaugauauugcgggugcuu	La Crosse Virus	M (G2)	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1422	ucaaacuugcgaacaccuu	La Crosse Virus	M (G2)	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1423	auauguuugcagcgcagauu	La Crosse Virus	M (G2)	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1425	aauggcuagucucugauug	La Crosse Virus	M (G2)	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1426	aauauacgggaguccucaacg	La Crosse Virus	L	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1427	agccagcacgcuacaugauu	La Crosse Virus	L	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi1429	aagacacaaccacuugcgga	La Crosse Virus	L	293T	Viral Titer	High	15596819	Blast SL	refseqs
virsi2288	aggcaguccucaacuauaa	Hazara Nairovirus	S	A549	Viral Titer	92	21600011	Blast SL	refseqs
virsi2287	agauuguugccaguacuaa	Hazara Nairovirus	S	A549	Viral Titer	88	21600011	Blast SL	refseqs
virsi2289	cgaugaugcgccaaagaga	Hazara Nairovirus	S	A549	Viral Titer	86	21600011	Blast SL	refseqs
virsi2292	cgagcauaaggguacaaua	Hazara Nairovirus	M	A549	Viral Titer	56	21600011	Blast SL	refseqs
virsi2291	cagucaugauggugguuua	Hazara Nairovirus	M	A549	Viral Titer	38	21600011	Blast SL	refseqs
virsi2295	cgaggauaauauuggcaaa	Hazara Nairovirus	L	A549	Viral Titer	34	21600011	Blast SL	refseqs
virsi2293	gaugaaaguugcuccuaua	Hazara Nairovirus	M	A549	Viral Titer	29	21600011	Blast SL	refseqs
virsi2290	caaagaccaagucgaccaa	Hazara Nairovirus	S	A549	Viral Titer	18	21600011	Blast SL	refseqs
virsi2294	caaauacuuugucaccaaa	Hazara Nairovirus	M	A549	Viral Titer	0	21600011	Blast SL	refseqs
virsi2296	cgaggauaauauuggcaaa	Hazara Nairovirus	L	A549	Viral Titer	0	21600011	Blast SL	refseqs



« previous12next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm