VIRsiRNAid | siRNA Sequence | Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
virsi2283 | cuaccgugugucuuggcca | Hepatitis B Virus [HBV] | ORF-S | HepG2.2.15 | Protein | Medium | 17926641 | Blast SL | refseqs |       | Pubmed:
17926641 Article:
The short hairpin RNA driven by polymerase II suppresses both wild-type and lamivudine-resistant hepatitis B virus strains.Authors:
Ren GL, Fang Y, Ma HH, Lei YF, Wang D, Xu MC, Wang PZ, Huang CX, Nie OH, Sun YT, Bai XF.Journal:
Antivir Ther. 2007;12(6):865-76.Entrez:
17926641
virsi2284 | gauccagcaucuagagacc | Hepatitis B Virus [HBV] | ORF-C | HepG2.2.15 | Protein | Medium | 17926641 | Blast SL | refseqs |       | Pubmed:
17926641 Article:
The short hairpin RNA driven by polymerase II suppresses both wild-type and lamivudine-resistant hepatitis B virus strains.Authors:
Ren GL, Fang Y, Ma HH, Lei YF, Wang D, Xu MC, Wang PZ, Huang CX, Nie OH, Sun YT, Bai XF.Journal:
Antivir Ther. 2007;12(6):865-76.Entrez:
17926641
virsi1669 | aagaacaauuauaguaaauca | Hepatitis B Virus [HBV] | C | BHK/HepG2 | RNA | Low | 19064272 | Blast SL | refseqs |       |
virsi1672 | gaggacucuuggacucucu | Hepatitis B Virus [HBV] | X | PLC/PRF/5 | RNA | Low | 16353167 | Blast SL | refseqs |       |
virsi1959 | auuccuaugggagugggcc | Hepatitis B Virus [HBV] | S | 293T | Protein | Low | 20642484 | Blast SL | refseqs |       |
virsi1674 | gagcacucuuggacucuca | Hepatitis B Virus [HBV] | X | HepG2.2.15 | RNA | Low | 16353167 | Blast SL | refseqs |       |
virsi1963 | cgaccuugaggcauacuuc | Hepatitis B Virus [HBV] | X | HepG2 | Protein | Low | 21107751 | Blast SL | refseqs |       |
virsi1032 | cgggacguccuuuguuuacgu | Hepatitis B Virus [HBV] | HBeAg | Huh-7 | Protein | Low | 19159285 | Blast SL | refseqs |       | Pubmed:
19159285 Article:
Controlling HBV replication in vivo by intravenous administration of triggered PEGylated siRNA-nanoparticles.Authors:
Carmona S, Jorgensen MR, Kolli S, Crowther C, Salazar FH, Marion PL, Fujino M, Natori Y, Thanou M, Arbuthnot P, Miller AD.Journal:
Mol Pharm. 2009 May-Jun;6(3):706-17.Entrez:
19159285
virsi1034 | ugggggaggagauuagguuaa | Hepatitis B Virus [HBV] | HBeAg | Huh-7 | Protein | Low | 19159285 | Blast SL | refseqs |       | Pubmed:
19159285 Article:
Controlling HBV replication in vivo by intravenous administration of triggered PEGylated siRNA-nanoparticles.Authors:
Carmona S, Jorgensen MR, Kolli S, Crowther C, Salazar FH, Marion PL, Fujino M, Natori Y, Thanou M, Arbuthnot P, Miller AD.Journal:
Mol Pharm. 2009 May-Jun;6(3):706-17.Entrez:
19159285
virsi1035 | agguuaaaggucuuuguauua | Hepatitis B Virus [HBV] | HBeAg | Huh-7 | Protein | Low | 19159285 | Blast SL | refseqs |       | Pubmed:
19159285 Article:
Controlling HBV replication in vivo by intravenous administration of triggered PEGylated siRNA-nanoparticles.Authors:
Carmona S, Jorgensen MR, Kolli S, Crowther C, Salazar FH, Marion PL, Fujino M, Natori Y, Thanou M, Arbuthnot P, Miller AD.Journal:
Mol Pharm. 2009 May-Jun;6(3):706-17.Entrez:
19159285
virsi1036 | aggcuguaggcauaaauuggu | Hepatitis B Virus [HBV] | HBeAg | Huh-7 | Protein | Low | 19159285 | Blast SL | refseqs |       | Pubmed:
19159285 Article:
Controlling HBV replication in vivo by intravenous administration of triggered PEGylated siRNA-nanoparticles.Authors:
Carmona S, Jorgensen MR, Kolli S, Crowther C, Salazar FH, Marion PL, Fujino M, Natori Y, Thanou M, Arbuthnot P, Miller AD.Journal:
Mol Pharm. 2009 May-Jun;6(3):706-17.Entrez:
19159285
virsi1038 | uggucugcgcaccaucaucau | Hepatitis B Virus [HBV] | HBeAg | Huh-7 | Protein | Low | 19159285 | Blast SL | refseqs |       | Pubmed:
19159285 Article:
Controlling HBV replication in vivo by intravenous administration of triggered PEGylated siRNA-nanoparticles.Authors:
Carmona S, Jorgensen MR, Kolli S, Crowther C, Salazar FH, Marion PL, Fujino M, Natori Y, Thanou M, Arbuthnot P, Miller AD.Journal:
Mol Pharm. 2009 May-Jun;6(3):706-17.Entrez:
19159285
virsi1139 | cauuguucaccucaccaua | Hepatitis B Virus [HBV] | C | Huh-7 | Protein | Low | 12753904 | Blast SL | refseqs |       |
virsi1994 | cauuguucaccucaccaua | Hepatitis B Virus [HBV] | C | HepG2 | Protein | Low | 12753904 | Blast SL | refseqs |       |
virsi1953 | gaugugucugcggcguuuuau | Hepatitis B Virus [HBV] | S | Huh-7 | mRNA | High | 20696079 | Blast SL | refseqs |       | Pubmed:
20696079 Article:
RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.Authors:
Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.Journal:
BMC Microbiol. 2010 Aug 10;10:214.Entrez:
20696079
virsi1673 | gcccaccaggucuugccc | Hepatitis B Virus [HBV] | X | HepG2.2.15 | RNA | High | 16353167 | Blast SL | refseqs |       |
virsi1951 | uccuacuguucaagccuccaa | Hepatitis B Virus [HBV] | C | HepG2 2.2.15 | mRNA | High | 20622325 | Blast SL | refseqs |       |
virsi1059 | gguauguugcccguuuguc | Hepatitis B Virus [HBV] | S | Huh-7 | Protein | 100 | 16153600 | Blast SL | refseqs |       |
virsi1060 | caaccaguacgggaccaug | Hepatitis B Virus [HBV] | S | Huh-7 | Protein | 100 | 16153600 | Blast SL | refseqs |       |
virsi1061 | gccucaucuucuuauuggu | Hepatitis B Virus [HBV] | S | Huh-7 | Protein | 100 | 16153600 | Blast SL | refseqs |       |
virsi1062 | ccuccaaucacucaccaac | Hepatitis B Virus [HBV] | S | Huh-7 | Protein | 100 | 16153600 | Blast SL | refseqs |       |
virsi1160 | gguauguugcccguuuguc | Hepatitis B Virus [HBV] | S | Huh-7 | Protein | 98 | 15765406 | Blast SL | refseqs |       |
virsi1666 | aaugucaacaaccgaccuuga | Hepatitis B Virus [HBV] | X | Hep3B | mRNA | 98 | 17296261 | Blast SL | refseqs |       |
virsi1460 | cauggagagcacaacauca | Hepatitis B Virus [HBV] | P/S | HepG2 | RNA | 98 | 14592428 | Blast SL | refseqs |       |
virsi1153 | cucaguuuacuagugccauuuguuc | Hepatitis B Virus [HBV] | P/S | HepG2.2.15 | Protein | 97 | 16900331 | Blast SL | refseqs |       |