VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 12740585 are 6
Results from 0 - 25

siRNA sequence "cucaguuuacuagugccauuuguuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cucaguuuacuagugccauuuguuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1469 " record
Length: 25
GC Content:40 %
Incubation Time (Hours):192

Offtargets for "cucaguuuacuagugccauuuguuc" siRNA in Human Genome sequences
See at Genbank
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585

siRNA sequence "ccuagaagaagaacucccucgccuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccuagaagaagaacucccucgccuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1470 " record
Length: 25
GC Content:56 %
Incubation Time (Hours):192

Offtargets for "ccuagaagaagaacucccucgccuc" siRNA in Human Genome sequences
See at Genbank
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585

siRNA sequence "augaugugguauugggggccaaguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "augaugugguauugggggccaaguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1471 " record
Length: 25
GC Content:52 %
Incubation Time (Hours):192

Offtargets for "augaugugguauugggggccaaguc" siRNA in Human Genome sequences
See at Genbank
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585

siRNA sequence "uggccaaaauucgcaguccccaacc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uggccaaaauucgcaguccccaacc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1472 " record
Length: 25
GC Content:56 %
Incubation Time (Hours):192

Offtargets for "uggccaaaauucgcaguccccaacc" siRNA in Human Genome sequences
See at Genbank
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585

siRNA sequence "agaagaucucaaucucgggaaucuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "agaagaucucaaucucgggaaucuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1474 " record
Length: 25
GC Content:44 %
Incubation Time (Hours):192

Offtargets for "agaagaucucaaucucgggaaucuc" siRNA in Human Genome sequences
See at Genbank
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585

siRNA sequence "uccccgucugugccuucucaucugc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uccccgucugugccuucucaucugc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1473 " record
Length: 25
GC Content:60 %
Incubation Time (Hours):192

Offtargets for "uccccgucugugccuucucaucugc" siRNA in Human Genome sequences
See at Genbank
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1469	cucaguuuacuagugccauuuguuc	Hepatitis B Virus [HBV]	P/S	Huh-7	Protein	94	12740585	Blast SL	refseqs
virsi1470	ccuagaagaagaacucccucgccuc	Hepatitis B Virus [HBV]	C/P	Huh-7	Protein	92	12740585	Blast SL	refseqs
virsi1471	augaugugguauugggggccaaguc	Hepatitis B Virus [HBV]	P/S	Huh-7	Protein	83	12740585	Blast SL	refseqs
virsi1472	uggccaaaauucgcaguccccaacc	Hepatitis B Virus [HBV]	P/S	Huh-7	Protein	80	12740585	Blast SL	refseqs
virsi1474	agaagaucucaaucucgggaaucuc	Hepatitis B Virus [HBV]	C/P	Huh-7	Protein	77	12740585	Blast SL	refseqs
virsi1473	uccccgucugugccuucucaucugc	Hepatitis B Virus [HBV]	X	Huh-7	Protein	70	12740585	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm