Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 20534349 are 7
Results from 0 - 25
siRNA sequence "ucacccaaauguacaccaaug" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ucacccaaauguacaccaaug" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1982 " record
Length: 21
GC Content:43 %
Starting position: 2027
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 2027
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "ucacccaaauguacaccaaug" siRNA in Human Genome sequences
See AJ242654 at Genbank
Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
siRNA sequence "ggucucguagaccgugcac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggucucguagaccgugcac" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1981 " record
Length: 19
GC Content:63 %
Starting position: 322
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 19
GC Content:63 %
Starting position: 322
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "ggucucguagaccgugcac" siRNA in Human Genome sequences
See AJ242654 at Genbank
Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
siRNA sequence "cauacccuccuguuuaacauc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "cauacccuccuguuuaacauc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1983 " record
Length: 21
GC Content:43 %
Starting position: 4150
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 4150
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "cauacccuccuguuuaacauc" siRNA in Human Genome sequences
See AJ242654 at Genbank
Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
siRNA sequence "ugcacgguguugacugauuuc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ugcacgguguugacugauuuc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1984 " record
Length: 21
GC Content:48 %
Starting position: 4690
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 4690
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "ugcacgguguugacugauuuc" siRNA in Human Genome sequences
See AJ242654 at Genbank
Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
siRNA sequence "gacacugagacaccaauugac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gacacugagacaccaauugac" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1985 " record
Length: 21
GC Content:48 %
Starting position: 6379
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 6379
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "gacacugagacaccaauugac" siRNA in Human Genome sequences
See AJ242654 at Genbank
Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
siRNA sequence "ggaugauccugaugacucauu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggaugauccugaugacucauu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1986 " record
Length: 21
GC Content:43 %
Starting position: 7259
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 7259
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "ggaugauccugaugacucauu" siRNA in Human Genome sequences
See AJ242654 at Genbank
Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
siRNA sequence "uguggugccuacuccuacuuu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "uguggugccuacuccuacuuu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1987 " record
Length: 21
GC Content:48 %
Starting position: 7712
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 7712
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "uguggugccuacuccuacuuu" siRNA in Human Genome sequences
See AJ242654 at Genbank
Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1982 | ucacccaaauguacaccaaug | Hepatitis C Virus [HCV] |  SL | refseqs |  | |||||
| virsi1981 | ggucucguagaccgugcac | Hepatitis C Virus [HCV] | SL | refseqs |  | |||||
| virsi1983 | cauacccuccuguuuaacauc | Hepatitis C Virus [HCV] |  SL | refseqs |  | |||||
| virsi1984 | ugcacgguguugacugauuuc | Hepatitis C Virus [HCV] | SL | refseqs |  | |||||
| virsi1985 | gacacugagacaccaauugac | Hepatitis C Virus [HCV] | SL | refseqs |  | |||||
| virsi1986 | ggaugauccugaugacucauu | Hepatitis C Virus [HCV] | SL | refseqs |  | |||||
| virsi1987 | uguggugccuacuccuacuuu | Hepatitis C Virus [HCV] | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands: siRNA Not specific SL: siRNA seedlocator algorithm