VIRsiRNAdb

Browse BY

Family of Virus

Virus Name

Gene Name

Pubmed Id

VsiRNAid

Total number of Results for

NS3

Results from

0 - 25

siRNA sequence "ucacccaaauguacaccaaug" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences

siRNA sequence matching with "ucacccaaauguacaccaaug" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus

Browse "virsi1982 " record
Length: 21
GC Content:43 %
Starting position: 2027
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ucacccaaauguacaccaaug" siRNA in Human Genome sequences

See AJ242654 at Genbank

Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349

siRNA sequence "gugucaaggaggaucgacu" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "gugucaaggaggaucgacu" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1101 " record
Length: 19
GC Content:53 %
Starting position: 4823
Strain of Virus: Linage
GenBank Acc: DQ211652
Transfection Reagent: Lipid-Based Reagent/Electroporation
Incubation Time (Hours):48

Offtargets for "gugucaaggaggaucgacu" siRNA in Human Genome sequences

See DQ211652 at Genbank

Pubmed:15985182
Article:Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA.
Authors:Geiss BJ, Pierson TC, Diamond MS.
Journal:Virol J. 2005 Jun 28;2:53.
Entrez:15985182

siRNA sequence "cucguccccuccggccguacc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences

siRNA sequence matching with "cucguccccuccggccguacc" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus

Browse "virsi2148 " record
Length: 21
GC Content:76 %
GenBank Acc: nM_031836
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "cucguccccuccggccguacc" siRNA in Human Genome sequences

See nM_031836 at Genbank

Pubmed:12594341
Article:RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Authors:Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
Journal:Proc Natl Acad Sci U S A. 2003 Mar 4;100(5):2783-8. Epub 2003 Feb 19.
Entrez:12594341

siRNA sequence "cgggaaagacgaagagaua" alignment with "Dengue Virus [DENV]" virus reference Genome sequences

siRNA sequence matching with "cgggaaagacgaagagaua" Dengue Virus [DENV]" Virus reference Genome sequences

Browse all the records for "Dengue Virus [DENV]" virus

Browse "virsi2325 " record
Length: 19
GC Content:47 %
Starting position: 5111
Strain of Virus: DENV-2
GenBank Acc: NC_001474
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "cgggaaagacgaagagaua" siRNA in Human Genome sequences

See NC_001474 at Genbank

Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "gggggggaggcaccucauuuu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences

siRNA sequence matching with "gggggggaggcaccucauuuu" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus

Browse "virsi2149 " record
Length: 21
GC Content:62 %
GenBank Acc: nM_002229
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gggggggaggcaccucauuuu" siRNA in Human Genome sequences

See nM_002229 at Genbank

siRNA sequence "ggggggaagacaucucauc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences

siRNA sequence matching with "ggggggaagacaucucauc" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus

Browse "virsi1180 " record
Length: 19
GC Content:58 %
Starting position: 4498
Strain of Virus: Genotype 1a
Incubation Time (Hours):72

Offtargets for "ggggggaagacaucucauc" siRNA in Human Genome sequences

See at Genbank

Pubmed:15977238
Article:Small interfering RNA effectively inhibits protein expression and negative strand RNA synthesis from a full-length hepatitis C virus clone.
Authors:Prabhu R, Vittal P, Yin Q, Flemington E, Garry R, Robichaux WH, Dash S.
Journal:J Med Virol. 2005 Aug;76(4):511-9.
Entrez:15977238

siRNA sequence "uuauggcaauggagucaua" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "uuauggcaauggagucaua" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi2196 " record
Length: 19
GC Content:37 %
Strain of Virus: Isolate 2741
GenBank Acc: AF206518
Incubation Time (Hours):24

Offtargets for "uuauggcaauggagucaua" siRNA in Human Genome sequences

See AF206518 at Genbank

Pubmed:19135091
Article:Effective siRNA targeting of the 3' untranslated region of the West Nile virus genome.
Authors:Anthony KG, Bai F, Krishnan MN, Fikrig E, Koski RA.
Journal:Antiviral Res. 2009 Jun;82(3):166-8. Epub 2009 Jan 7.
Entrez:19135091

siRNA sequence "aacgagguuacuaccacacac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences

siRNA sequence matching with "aacgagguuacuaccacacac" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus

Browse "virsi2137 " record
Length: 21
GC Content:48 %
Starting position: 8373
Strain of Virus: Isolate Con1
GenBank Acc: AJ238799
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "aacgagguuacuaccacacac" siRNA in Human Genome sequences

See AJ238799 at Genbank

Pubmed:16979254
Article:Inhibition of hepatitis C virus gene expression by small interfering RNAs using a tri-cistronic full-length viral replicon and a transient mouse model.
Authors:Kim M, Shin D, Kim SI, Park M.
Journal:Virus Res. 2006 Dec;122(1-2):1-10. Epub 2006 Sep 15.
Entrez:16979254

siRNA sequence "ggcaaagccauccccauug" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences

siRNA sequence matching with "ggcaaagccauccccauug" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus

Browse "virsi1988 " record
Length: 19
GC Content:58 %
Starting position: 4470
Strain of Virus: Genotype 1b
GenBank Acc: GU451218
Transfection Reagent: PAMAM-Arg
Incubation Time (Hours):48

Offtargets for "ggcaaagccauccccauug" siRNA in Human Genome sequences

See GU451218 at Genbank

Pubmed:20863235
Article:Suppression of hepatitis C virus genome replication in cells with RNA-cleaving DNA enzymes and short-hairpin RNA.
Authors:Lee B, Kim KB, Oh S, Choi JS, Park JS, Min DH, Kim DE.
Journal:Oligonucleotides. 2010 Dec;20(6):285-96. Epub 2010 Sep 23.
Entrez:20863235

siRNA sequence "ccaaauacaucauggcaug" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences

siRNA sequence matching with "ccaaauacaucauggcaug" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus

Browse "virsi1973 " record
Length: 19
GC Content:42 %
Starting position: 4934
Strain of Virus: Genotype 1b
GenBank Acc: EU781832
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):48

Offtargets for "ccaaauacaucauggcaug" siRNA in Human Genome sequences

See EU781832 at Genbank

Pubmed:20464448
Article:Comparative analysis of intracellular inhibition of hepatitis C virus replication by small interfering RNAs.
Authors:Chang B, Lee CH, Lee JH, Lee SW.
Journal:Biotechnol Lett. 2010 Sep;32(9):1231-7. Epub 2010 May 13.
Entrez:20464448

siRNA sequence "aacaggcagcguggucauugu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences

siRNA sequence matching with "aacaggcagcguggucauugu" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus

Browse "virsi2138 " record
Length: 21
GC Content:52 %
Starting position: 8504
Strain of Virus: Isolate Con1
GenBank Acc: AJ238799
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "aacaggcagcguggucauugu" siRNA in Human Genome sequences

See AJ238799 at Genbank

VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With
virsi1982	ucacccaaauguacaccaaug	Hepatitis C Virus [HCV]	NS3	Huh-7	RNA	Medium	20534349	Blast SL	refseqs
virsi1101	gugucaaggaggaucgacu	West Nile Virus [WNV]	NS3	Huh-7 .5	Protein	Medium	15985182	Blast SL	refseqs
virsi2148	cucguccccuccggccguacc	Hepatitis C Virus [HCV]	NS3	Huh-7	Protein	Medium	12594341	Blast SL	refseqs
virsi2325	cgggaaagacgaagagaua	Dengue Virus [DENV]	NS3	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2149	gggggggaggcaccucauuuu	Hepatitis C Virus [HCV]	NS3	Huh-7	Protein	High	12594341	Blast SL	refseqs
virsi1180	ggggggaagacaucucauc	Hepatitis C Virus [HCV]	NS3	Huh-7	RNA	80	15977238	Blast SL	refseqs
virsi2196	uuauggcaauggagucaua	West Nile Virus [WNV]	NS3	Vero	mRNA	70	19135091	Blast SL	refseqs
virsi2137	aacgagguuacuaccacacac	Hepatitis C Virus [HCV]	NS3	Huh-7	RNA	63	16979254	Blast SL	refseqs
virsi1988	ggcaaagccauccccauug	Hepatitis C Virus [HCV]	NS3	Huh-7	Protein	60	20863235	Blast SL	refseqs
virsi1973	ccaaauacaucauggcaug	Hepatitis C Virus [HCV]	NS3	Huh-7	mRNA	60	20464448	Blast SL	refseqs
virsi2138	aacaggcagcguggucauugu	Hepatitis C Virus [HCV]	NS3	Huh-7	RNA	35	16979254	Blast SL	refseqs

: siRNA seedlocator algorithm

VIRsiRNAdb

Database of Viral siRNA / shRNA

Browse BY