VIRsiRNAdb

siRNA sequence "gaagaacgcuguaguggau" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "gaagaacgcuguaguggau" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1106 " record
Length: 19
GC Content:47 %
Starting position: 7353
Strain of Virus: Linage
GenBank Acc: DQ211652
Transfection Reagent: Lipid-Based Reagent/Electroporation
Incubation Time (Hours):48

Offtargets for "gaagaacgcuguaguggau" siRNA in Human Genome sequences

See DQ211652 at Genbank

Pubmed:15985182
Article:Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA.
Authors:Geiss BJ, Pierson TC, Diamond MS.
Journal:Virol J. 2005 Jun 28;2:53.
Entrez:15985182

siRNA sequence "ggacgcaccuugggagaggu" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "ggacgcaccuugggagaggu" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1107 " record
Length: 20
GC Content:65 %
Starting position: 7693
Strain of Virus: Linage
GenBank Acc: DQ211652
Transfection Reagent: Lipid-Based Reagent/Electroporation
Incubation Time (Hours):48

Offtargets for "ggacgcaccuugggagaggu" siRNA in Human Genome sequences

See DQ211652 at Genbank

Pubmed:15985182
Article:Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA.
Authors:Geiss BJ, Pierson TC, Diamond MS.
Journal:Virol J. 2005 Jun 28;2:53.
Entrez:15985182

siRNA sequence "ggucaacagcaaugcagcu" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "ggucaacagcaaugcagcu" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1108 " record
Length: 19
GC Content:53 %
Starting position: 8892
Strain of Virus: Linage
GenBank Acc: DQ211652
Transfection Reagent: Lipid-Based Reagent/Electroporation
Incubation Time (Hours):48

Offtargets for "ggucaacagcaaugcagcu" siRNA in Human Genome sequences

See DQ211652 at Genbank

Pubmed:15985182
Article:Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA.
Authors:Geiss BJ, Pierson TC, Diamond MS.
Journal:Virol J. 2005 Jun 28;2:53.
Entrez:15985182

siRNA sequence "cagcaaugcagcuuugggu" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "cagcaaugcagcuuugggu" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1109 " record
Length: 19
GC Content:53 %
Starting position: 8898
Strain of Virus: Linage
GenBank Acc: DQ211652
Transfection Reagent: Lipid-Based Reagent/Electroporation
Incubation Time (Hours):48

Offtargets for "cagcaaugcagcuuugggu" siRNA in Human Genome sequences

See DQ211652 at Genbank

Pubmed:15985182
Article:Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA.
Authors:Geiss BJ, Pierson TC, Diamond MS.
Journal:Virol J. 2005 Jun 28;2:53.
Entrez:15985182

siRNA sequence "gaagcagagccauuugguu" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "gaagcagagccauuugguu" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1110 " record
Length: 19
GC Content:47 %
Starting position: 9095
Strain of Virus: Linage
GenBank Acc: DQ211652
Transfection Reagent: Lipid-Based Reagent/Electroporation
Incubation Time (Hours):48

Offtargets for "gaagcagagccauuugguu" siRNA in Human Genome sequences

See DQ211652 at Genbank

Pubmed:15985182
Article:Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA.
Authors:Geiss BJ, Pierson TC, Diamond MS.
Journal:Virol J. 2005 Jun 28;2:53.
Entrez:15985182

siRNA sequence "gggaaaggacccaaaguca" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "gggaaaggacccaaaguca" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1111 " record
Length: 19
GC Content:53 %
Starting position: 9607
Strain of Virus: Linage
GenBank Acc: DQ211652
Transfection Reagent: Lipid-Based Reagent/Electroporation
Incubation Time (Hours):48

Offtargets for "gggaaaggacccaaaguca" siRNA in Human Genome sequences

See DQ211652 at Genbank

Pubmed:15985182
Article:Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA.
Authors:Geiss BJ, Pierson TC, Diamond MS.
Journal:Virol J. 2005 Jun 28;2:53.
Entrez:15985182

siRNA sequence "gagagauaugaagacacaac" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "gagagauaugaagacacaac" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1112 " record
Length: 20
GC Content:40 %
Starting position: 10335
Strain of Virus: Linage
GenBank Acc: DQ211652
Transfection Reagent: Lipid-Based Reagent/Electroporation
Incubation Time (Hours):48

Offtargets for "gagagauaugaagacacaac" siRNA in Human Genome sequences

See DQ211652 at Genbank

Pubmed:15985182
Article:Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA.
Authors:Geiss BJ, Pierson TC, Diamond MS.
Journal:Virol J. 2005 Jun 28;2:53.
Entrez:15985182

siRNA sequence "ggauggagcuugagagaaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences

siRNA sequence matching with "ggauggagcuugagagaaa" Dengue Virus [DENV]" Virus reference Genome sequences

Browse all the records for "Dengue Virus [DENV]" virus

Browse "virsi2324 " record
Length: 19
GC Content:47 %
Starting position: 9803
Strain of Virus: DENV-1
GenBank Acc: DVU88536
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ggauggagcuugagagaaa" siRNA in Human Genome sequences

See DVU88536 at Genbank

Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "ccaaagagguaguggacaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences

siRNA sequence matching with "ccaaagagguaguggacaa" Dengue Virus [DENV]" Virus reference Genome sequences

Browse all the records for "Dengue Virus [DENV]" virus

Browse "virsi2326 " record
Length: 19
GC Content:47 %
Starting position: 9360
Strain of Virus: DENV-2
GenBank Acc: NC_001474
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ccaaagagguaguggacaa" siRNA in Human Genome sequences

See NC_001474 at Genbank

Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "gaggaaugcuugugagaaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences

siRNA sequence matching with "gaggaaugcuugugagaaa" Dengue Virus [DENV]" Virus reference Genome sequences

Browse all the records for "Dengue Virus [DENV]" virus

Browse "virsi2327 " record
Length: 19
GC Content:42 %
Starting position: 8096
Strain of Virus: DENV-3
GenBank Acc: M93130
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "gaggaaugcuugugagaaa" siRNA in Human Genome sequences

See M93130 at Genbank

Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "ggauggagccuuagagaaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences

siRNA sequence matching with "ggauggagccuuagagaaa" Dengue Virus [DENV]" Virus reference Genome sequences

Browse all the records for "Dengue Virus [DENV]" virus

Browse "virsi2328 " record
Length: 19
GC Content:47 %
Starting position: 9727
Strain of Virus: DENV-3
GenBank Acc: M93130
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ggauggagccuuagagaaa" siRNA in Human Genome sequences

See M93130 at Genbank

Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "ccaaagagguaguggacaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences

siRNA sequence matching with "ccaaagagguaguggacaa" Dengue Virus [DENV]" Virus reference Genome sequences

Browse all the records for "Dengue Virus [DENV]" virus

Browse "virsi2329 " record
Length: 19
GC Content:47 %
Starting position: 9353
Strain of Virus: DENV-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ccaaagagguaguggacaa" siRNA in Human Genome sequences

See AY947539 at Genbank

Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "cagagccauuugguucaugug" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "cagagccauuugguucaugug" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi2146 " record
Length: 21
GC Content:48 %
GenBank Acc: NC_001563
Transfection Reagent: TransIT-LT1

Offtargets for "cagagccauuugguucaugug" siRNA in Human Genome sequences

See NC_001563 at Genbank

Pubmed:12954218
Article:The utility of siRNA transcripts produced by RNA polymerase i in down regulating viral gene expression and replication of negative- and positive-strand RNA viruses.
Authors:McCown M, Diamond MS, Pekosz A.
Journal:Virology. 2003 Sep 1;313(2):514-24.
Entrez:12954218

siRNA sequence "cugugacauuggagaguca" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "cugugacauuggagaguca" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1250 " record
Length: 19
GC Content:47 %
Starting position: 8103
Strain of Virus: B956
GenBank Acc: AY532665
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "cugugacauuggagaguca" siRNA in Human Genome sequences

See AY532665 at Genbank

Pubmed:21423625
Article:Silencing early viral replication in macrophages and dendritic cells effectively suppresses flavivirus encephalitis.
Authors:Ye C, Abraham S, Wu H, Shankar P, Manjunath N.
Journal:PLoS One. 2011 Mar 15;6(3):e17889.
Entrez:21423625

siRNA sequence "ugcucugugacauuggaga" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "ugcucugugacauuggaga" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1230 " record
Length: 19
GC Content:47 %
Starting position: 8099
Strain of Virus: B956
GenBank Acc: AY532665
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "ugcucugugacauuggaga" siRNA in Human Genome sequences

See AY532665 at Genbank

Pubmed:21423625
Article:Silencing early viral replication in macrophages and dendritic cells effectively suppresses flavivirus encephalitis.
Authors:Ye C, Abraham S, Wu H, Shankar P, Manjunath N.
Journal:PLoS One. 2011 Mar 15;6(3):e17889.
Entrez:21423625

siRNA sequence "ugcucugugacauuggaga" alignment with "St. Louis Encephalitis [SLE]" virus reference Genome sequences

siRNA sequence matching with "ugcucugugacauuggaga" St. Louis Encephalitis [SLE]" Virus reference Genome sequences

Browse all the records for "St. Louis Encephalitis [SLE]" virus

Browse "virsi1225 " record
Length: 19
GC Content:47 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "ugcucugugacauuggaga" siRNA in Human Genome sequences

See at Genbank

Pubmed:21423625
Article:Silencing early viral replication in macrophages and dendritic cells effectively suppresses flavivirus encephalitis.
Authors:Ye C, Abraham S, Wu H, Shankar P, Manjunath N.
Journal:PLoS One. 2011 Mar 15;6(3):e17889.
Entrez:21423625

siRNA sequence "cugugacauuggagaguca" alignment with "St. Louis Encephalitis [SLE]" virus reference Genome sequences

siRNA sequence matching with "cugugacauuggagaguca" St. Louis Encephalitis [SLE]" Virus reference Genome sequences

Browse all the records for "St. Louis Encephalitis [SLE]" virus

Browse "virsi1227 " record
Length: 19
GC Content:47 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "cugugacauuggagaguca" siRNA in Human Genome sequences

See at Genbank

Pubmed:21423625
Article:Silencing early viral replication in macrophages and dendritic cells effectively suppresses flavivirus encephalitis.
Authors:Ye C, Abraham S, Wu H, Shankar P, Manjunath N.
Journal:PLoS One. 2011 Mar 15;6(3):e17889.
Entrez:21423625

siRNA sequence "agagccauuugguucaugu" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "agagccauuugguucaugu" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi2205 " record
Length: 19
GC Content:42 %
Strain of Virus: Isolate 2741
GenBank Acc: AF206518
Incubation Time (Hours):24

Offtargets for "agagccauuugguucaugu" siRNA in Human Genome sequences

See AF206518 at Genbank

Pubmed:19135091
Article:Effective siRNA targeting of the 3' untranslated region of the West Nile virus genome.
Authors:Anthony KG, Bai F, Krishnan MN, Fikrig E, Koski RA.
Journal:Antiviral Res. 2009 Jun;82(3):166-8. Epub 2009 Jan 7.
Entrez:19135091

siRNA sequence "gcuaaggugcuugagcugc" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "gcuaaggugcuugagcugc" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1489 " record
Length: 19
GC Content:58 %
Starting position: 9335
Strain of Virus: NY99
GenBank Acc: NC_009942
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24

Offtargets for "gcuaaggugcuugagcugc" siRNA in Human Genome sequences

See NC_009942 at Genbank

Pubmed:18360908
Article:Inhibition of West Nile Virus replication by retrovirus-delivered small interfering RNA in human neuroblastoma cells.
Authors:Yang Y, Wu C, Wu J, Nerurkar VR, Yanagihara R, Lu Y.
Journal:J Med Virol. 2008 May;80(5):930-6.
Entrez:18360908

siRNA sequence "ggaccgacauuguggaggu" alignment with "Yellow Fever Virus" virus reference Genome sequences

siRNA sequence matching with "ggaccgacauuguggaggu" Yellow Fever Virus" Virus reference Genome sequences

Browse all the records for "Yellow Fever Virus" virus

Browse "virsi2305 " record
Length: 19
GC Content:58 %
Strain of Virus: 17DD
GenBank Acc: NC_002031
Transfection Reagent: Lipofectamine 2000

Offtargets for "ggaccgacauuguggaggu" siRNA in Human Genome sequences

See NC_002031 at Genbank

Pubmed:19169857
Article:RNA interference inhibits yellow fever virus replication in vitro and in vivo.
Authors:Pacca CC, Severino AA, Mondini A, Rahal P, D'avila SG, Cordeiro JA, Nogueira MC, Bronzoni RV, Nogueira ML.
Journal:Virus Genes. 2009 Apr;38(2):224-31. Epub 2009 Jan 25.
Entrez:19169857

siRNA sequence "ucugugacauuggagaguc" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "ucugugacauuggagaguc" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1233 " record
Length: 19
GC Content:47 %
Starting position: 8102
Strain of Virus: B956
GenBank Acc: AY532665
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "ucugugacauuggagaguc" siRNA in Human Genome sequences

See AY532665 at Genbank

Pubmed:21423625
Article:Silencing early viral replication in macrophages and dendritic cells effectively suppresses flavivirus encephalitis.
Authors:Ye C, Abraham S, Wu H, Shankar P, Manjunath N.
Journal:PLoS One. 2011 Mar 15;6(3):e17889.
Entrez:21423625

siRNA sequence "gcucugugacauuggagag" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "gcucugugacauuggagag" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1229 " record
Length: 19
GC Content:53 %
Starting position: 8100
Strain of Virus: B956
GenBank Acc: AY532665
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gcucugugacauuggagag" siRNA in Human Genome sequences

See AY532665 at Genbank

Pubmed:21423625
Article:Silencing early viral replication in macrophages and dendritic cells effectively suppresses flavivirus encephalitis.
Authors:Ye C, Abraham S, Wu H, Shankar P, Manjunath N.
Journal:PLoS One. 2011 Mar 15;6(3):e17889.
Entrez:21423625

siRNA sequence "aggagguuuggcggaacag" alignment with "Yellow Fever Virus" virus reference Genome sequences

siRNA sequence matching with "aggagguuuggcggaacag" Yellow Fever Virus" Virus reference Genome sequences

Browse all the records for "Yellow Fever Virus" virus

Browse "virsi2306 " record
Length: 19
GC Content:58 %
Strain of Virus: 17DD
GenBank Acc: NC_002031
Transfection Reagent: Lipofectamine 2000

Offtargets for "aggagguuuggcggaacag" siRNA in Human Genome sequences

See NC_002031 at Genbank

Pubmed:19169857
Article:RNA interference inhibits yellow fever virus replication in vitro and in vivo.
Authors:Pacca CC, Severino AA, Mondini A, Rahal P, D'avila SG, Cordeiro JA, Nogueira MC, Bronzoni RV, Nogueira ML.
Journal:Virus Genes. 2009 Apr;38(2):224-31. Epub 2009 Jan 25.
Entrez:19169857

siRNA sequence "cacaugagauguacugggu" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "cacaugagauguacugggu" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1231 " record
Length: 19
GC Content:47 %
Starting position: 8320
Strain of Virus: B956
GenBank Acc: AY532665
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "cacaugagauguacugggu" siRNA in Human Genome sequences

See AY532665 at Genbank

Pubmed:21423625
Article:Silencing early viral replication in macrophages and dendritic cells effectively suppresses flavivirus encephalitis.
Authors:Ye C, Abraham S, Wu H, Shankar P, Manjunath N.
Journal:PLoS One. 2011 Mar 15;6(3):e17889.
Entrez:21423625

siRNA sequence "augcccugaacaccuucac" alignment with "West Nile Virus [WNV]" virus reference Genome sequences

siRNA sequence matching with "augcccugaacaccuucac" West Nile Virus [WNV]" Virus reference Genome sequences

Browse all the records for "West Nile Virus [WNV]" virus

Browse "virsi1240 " record
Length: 19
GC Content:53 %
Starting position: 9502
Strain of Virus: B956
GenBank Acc: AY532665
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "augcccugaacaccuucac" siRNA in Human Genome sequences

See AY532665 at Genbank

Pubmed:21423625
Article:Silencing early viral replication in macrophages and dendritic cells effectively suppresses flavivirus encephalitis.
Authors:Ye C, Abraham S, Wu H, Shankar P, Manjunath N.
Journal:PLoS One. 2011 Mar 15;6(3):e17889.
Entrez:21423625

VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With
virsi1106	gaagaacgcuguaguggau	West Nile Virus [WNV]	NS5	Huh-7 .5	Protein	Low	15985182	Blast SL	refseqs
virsi1107	ggacgcaccuugggagaggu	West Nile Virus [WNV]	NS5	Huh-7 .5	Protein	Low	15985182	Blast SL	refseqs
virsi1108	ggucaacagcaaugcagcu	West Nile Virus [WNV]	NS5	Huh-7 .5	Protein	Low	15985182	Blast SL	refseqs
virsi1109	cagcaaugcagcuuugggu	West Nile Virus [WNV]	NS5	Huh-7 .5	Protein	Low	15985182	Blast SL	refseqs
virsi1110	gaagcagagccauuugguu	West Nile Virus [WNV]	NS5	Huh-7 .5	Protein	Low	15985182	Blast SL	refseqs
virsi1111	gggaaaggacccaaaguca	West Nile Virus [WNV]	NS5	Huh-7 .5	Protein	Low	15985182	Blast SL	refseqs
virsi1112	gagagauaugaagacacaac	West Nile Virus [WNV]	NS5	Huh-7 .5	Protein	Low	15985182	Blast SL	refseqs
virsi2324	ggauggagcuugagagaaa	Dengue Virus [DENV]	NS5	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2326	ccaaagagguaguggacaa	Dengue Virus [DENV]	NS5	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2327	gaggaaugcuugugagaaa	Dengue Virus [DENV]	NS5	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2328	ggauggagccuuagagaaa	Dengue Virus [DENV]	NS5	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2329	ccaaagagguaguggacaa	Dengue Virus [DENV]	NS5	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2146	cagagccauuugguucaugug	West Nile Virus [WNV]	NS5	293T	Protein	High	12954218	Blast SL	refseqs
virsi1250	cugugacauuggagaguca	West Nile Virus [WNV]	NS5	BHK-21	Cell Count	100	21423625	Blast SL	refseqs
virsi1230	ugcucugugacauuggaga	West Nile Virus [WNV]	NS5	BHK-21	Cell Count	95	21423625	Blast SL	refseqs
virsi1225	ugcucugugacauuggaga	St. Louis Encephalitis [SLE]	NS5	BHK-21	Cell Count	85	21423625	Blast SL	refseqs
virsi1227	cugugacauuggagaguca	St. Louis Encephalitis [SLE]	NS5	BHK-21	Cell Count	83	21423625	Blast SL	refseqs
virsi2205	agagccauuugguucaugu	West Nile Virus [WNV]	NS5	Vero	mRNA	75	19135091	Blast SL	refseqs
virsi1489	gcuaaggugcuugagcugc	West Nile Virus [WNV]	NS5	HTB Cells	Cell Count	30	18360908	Blast SL	refseqs
virsi2305	ggaccgacauuguggaggu	Yellow Fever Virus	NS5	Vero E6	Plaque Count	29	19169857	Blast SL	refseqs
virsi1233	ucugugacauuggagaguc	West Nile Virus [WNV]	NS5	BHK-21	Cell Count	26	21423625	Blast SL	refseqs
virsi1229	gcucugugacauuggagag	West Nile Virus [WNV]	NS5	BHK-21	Cell Count	24	21423625	Blast SL	refseqs
virsi2306	aggagguuuggcggaacag	Yellow Fever Virus	NS5	Vero E6	Plaque Count	12	19169857	Blast SL	refseqs
virsi1231	cacaugagauguacugggu	West Nile Virus [WNV]	NS5	BHK-21	Cell Count	5	21423625	Blast SL	refseqs
virsi1240	augcccugaacaccuucac	West Nile Virus [WNV]	NS5	BHK-21	Cell Count	5	21423625	Blast SL	refseqs

VIRsiRNAdb

Database of Viral siRNA / shRNA

Browse BY