Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for E are 39
Results from 0 - 25
siRNA sequence "gggcaaugguugugggcua" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "gggcaaugguugugggcua" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2323 " record
Length: 19
GC Content:58 %
Starting position: 1237
Strain of Virus: DENV-1
GenBank Acc: DVU88535
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 19
GC Content:58 %
Starting position: 1237
Strain of Virus: DENV-1
GenBank Acc: DVU88535
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "gggcaaugguugugggcua" siRNA in Human Genome sequences
See DVU88535 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
siRNA sequence "ggcugcggacuguuuggaa" alignment with "West Nile Virus [WNV]" virus reference Genome sequences
siRNA sequence matching with "ggcugcggacuguuuggaa" West Nile Virus [WNV]" Virus reference Genome sequences
Browse all the records for "West Nile Virus [WNV]" virus
Browse "virsi1497 " record
Length: 19
GC Content:58 %
Starting position: 1287
GenBank Acc: NC_009942
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Length: 19
GC Content:58 %
Starting position: 1287
GenBank Acc: NC_009942
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Offtargets for "ggcugcggacuguuuggaa" siRNA in Human Genome sequences
See NC_009942 at Genbank
Pubmed:16464133
Article:A single siRNA suppresses fatal encephalitis induced by two different flaviviruses.
Authors:Kumar P, Lee SK, Shankar P, Manjunath N.
Journal:PLoS Med. 2006 Apr;3(4):e96. Epub 2006 Feb 14.
Entrez:16464133
Article:A single siRNA suppresses fatal encephalitis induced by two different flaviviruses.
Authors:Kumar P, Lee SK, Shankar P, Manjunath N.
Journal:PLoS Med. 2006 Apr;3(4):e96. Epub 2006 Feb 14.
Entrez:16464133
siRNA sequence "ggcugaucaacaccaacggca" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggcugaucaacaccaacggca" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2276 " record
Length: 21
GC Content:57 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48
Length: 21
GC Content:57 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48
Offtargets for "ggcugaucaacaccaacggca" siRNA in Human Genome sequences
See M62321 at Genbank
Pubmed:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893
siRNA sequence "ggauguggauuauuuggaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "ggauguggauuauuuggaa" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi1506 " record
Length: 19
GC Content:37 %
GenBank Acc: NC_001474
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Length: 19
GC Content:37 %
GenBank Acc: NC_001474
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Offtargets for "ggauguggauuauuuggaa" siRNA in Human Genome sequences
See NC_001474 at Genbank
Pubmed:20015996
Article:Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.
Authors:Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.
Journal:J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.
Entrez:20015996
Article:Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.
Authors:Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.
Journal:J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.
Entrez:20015996
siRNA sequence "agagguccgcaguuauugc" alignment with "West Nile Virus [WNV]" virus reference Genome sequences
siRNA sequence matching with "agagguccgcaguuauugc" West Nile Virus [WNV]" Virus reference Genome sequences
Browse all the records for "West Nile Virus [WNV]" virus
Browse "virsi2197 " record
Length: 19
GC Content:53 %
Strain of Virus: Isolate 2741
GenBank Acc: AF206518
Incubation Time (Hours):24
Length: 19
GC Content:53 %
Strain of Virus: Isolate 2741
GenBank Acc: AF206518
Incubation Time (Hours):24
Offtargets for "agagguccgcaguuauugc" siRNA in Human Genome sequences
See AF206518 at Genbank
Pubmed:19135091
Article:Effective siRNA targeting of the 3' untranslated region of the West Nile virus genome.
Authors:Anthony KG, Bai F, Krishnan MN, Fikrig E, Koski RA.
Journal:Antiviral Res. 2009 Jun;82(3):166-8. Epub 2009 Jan 7.
Entrez:19135091
Article:Effective siRNA targeting of the 3' untranslated region of the West Nile virus genome.
Authors:Anthony KG, Bai F, Krishnan MN, Fikrig E, Koski RA.
Journal:Antiviral Res. 2009 Jun;82(3):166-8. Epub 2009 Jan 7.
Entrez:19135091
siRNA sequence "ggauguggacuuuucggga" alignment with "Japanese Encephalitis Virus [JE]" virus reference Genome sequences
siRNA sequence matching with "ggauguggacuuuucggga" Japanese Encephalitis Virus [JE]" Virus reference Genome sequences
Browse all the records for "Japanese Encephalitis Virus [JE]" virus
Browse "virsi1498 " record
Length: 19
GC Content:53 %
Starting position: 1287
GenBank Acc: NC_006551
Transfection Reagent: Lipofectamine
Length: 19
GC Content:53 %
Starting position: 1287
GenBank Acc: NC_006551
Transfection Reagent: Lipofectamine
Offtargets for "ggauguggacuuuucggga" siRNA in Human Genome sequences
See NC_006551 at Genbank
Pubmed:16464133
Article:A single siRNA suppresses fatal encephalitis induced by two different flaviviruses.
Authors:Kumar P, Lee SK, Shankar P, Manjunath N.
Journal:PLoS Med. 2006 Apr;3(4):e96. Epub 2006 Feb 14.
Entrez:16464133
Article:A single siRNA suppresses fatal encephalitis induced by two different flaviviruses.
Authors:Kumar P, Lee SK, Shankar P, Manjunath N.
Journal:PLoS Med. 2006 Apr;3(4):e96. Epub 2006 Feb 14.
Entrez:16464133
siRNA sequence "gggagcauugacacaugugca" alignment with "Japanese Encephalitis Virus [JE]" virus reference Genome sequences
siRNA sequence matching with "gggagcauugacacaugugca" Japanese Encephalitis Virus [JE]" Virus reference Genome sequences
Browse all the records for "Japanese Encephalitis Virus [JE]" virus
Browse "virsi1499 " record
Length: 21
GC Content:52 %
Starting position: 1307
GenBank Acc: 16464133
Transfection Reagent: Lipofectamine
Length: 21
GC Content:52 %
Starting position: 1307
GenBank Acc: 16464133
Transfection Reagent: Lipofectamine
Offtargets for "gggagcauugacacaugugca" siRNA in Human Genome sequences
See 16464133 at Genbank
Pubmed:16464133
Article:A single siRNA suppresses fatal encephalitis induced by two different flaviviruses.
Authors:Kumar P, Lee SK, Shankar P, Manjunath N.
Journal:PLoS Med. 2006 Apr;3(4):e96. Epub 2006 Feb 14.
Entrez:16464133
Article:A single siRNA suppresses fatal encephalitis induced by two different flaviviruses.
Authors:Kumar P, Lee SK, Shankar P, Manjunath N.
Journal:PLoS Med. 2006 Apr;3(4):e96. Epub 2006 Feb 14.
Entrez:16464133
siRNA sequence "ggcgcagcuucgacgucauau" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggcgcagcuucgacgucauau" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2277 " record
Length: 21
GC Content:57 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48
Length: 21
GC Content:57 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48
Offtargets for "ggcgcagcuucgacgucauau" siRNA in Human Genome sequences
See M62321 at Genbank
Pubmed:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893
siRNA sequence "cauagaagcagaaccucca" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "cauagaagcagaaccucca" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi1505 " record
Length: 19
GC Content:47 %
GenBank Acc: NC_001474
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Length: 19
GC Content:47 %
GenBank Acc: NC_001474
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Offtargets for "cauagaagcagaaccucca" siRNA in Human Genome sequences
See NC_001474 at Genbank
Pubmed:20015996
Article:Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.
Authors:Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.
Journal:J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.
Entrez:20015996
Article:Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.
Authors:Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.
Journal:J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.
Entrez:20015996
siRNA sequence "cauaucuaggugcuggacc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "cauaucuaggugcuggacc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1965 " record
Length: 19
GC Content:53 %
Starting position: 129
Strain of Virus: 3a
GenBank Acc: FJ790798
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:53 %
Starting position: 129
Strain of Virus: 3a
GenBank Acc: FJ790798
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cauaucuaggugcuggacc" siRNA in Human Genome sequences
See FJ790798 at Genbank
Pubmed:21161551
Article:Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes.
Authors:Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S.
Journal:Arch Virol. 2011 Mar;156(3):433-42. Epub 2010 Dec 16.
Entrez:21161551
Article:Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes.
Authors:Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S.
Journal:Arch Virol. 2011 Mar;156(3):433-42. Epub 2010 Dec 16.
Entrez:21161551
siRNA sequence "acacaacauggaacaauag" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "acacaacauggaacaauag" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi1504 " record
Length: 19
GC Content:37 %
GenBank Acc: NC_001474
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Length: 19
GC Content:37 %
GenBank Acc: NC_001474
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Offtargets for "acacaacauggaacaauag" siRNA in Human Genome sequences
See NC_001474 at Genbank
Pubmed:20015996
Article:Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.
Authors:Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.
Journal:J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.
Entrez:20015996
Article:Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.
Authors:Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.
Journal:J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.
Entrez:20015996
siRNA sequence "gguugguucgguuguaccugg" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gguugguucgguuguaccugg" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2275 " record
Length: 21
GC Content:57 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48
Length: 21
GC Content:57 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48
Offtargets for "gguugguucgguuguaccugg" siRNA in Human Genome sequences
See M62321 at Genbank
Pubmed:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893
siRNA sequence "gcugcgugacuaucauguc" alignment with "West Nile Virus [WNV]" virus reference Genome sequences
siRNA sequence matching with "gcugcgugacuaucauguc" West Nile Virus [WNV]" Virus reference Genome sequences
Browse all the records for "West Nile Virus [WNV]" virus
Browse "virsi1491 " record
Length: 19
GC Content:53 %
Starting position: 86
Strain of Virus: WNV Isolate 2471
GenBank Acc: HA063760
Transfection Reagent: siPORT Amine/Lipid
Incubation Time (Hours):24
Length: 19
GC Content:53 %
Starting position: 86
Strain of Virus: WNV Isolate 2471
GenBank Acc: HA063760
Transfection Reagent: siPORT Amine/Lipid
Incubation Time (Hours):24
Offtargets for "gcugcgugacuaucauguc" siRNA in Human Genome sequences
See HA063760 at Genbank
Pubmed:15747251
Article:Use of RNA interference to prevent lethal murine west nile virus infection.
Authors:Bai F, Wang T, Pal U, Bao F, Gould LH, Fikrig E.
Journal:J Infect Dis. 2005 Apr 1;191(7):1148-54. Epub 2005 Feb 23.
Entrez:15747251
Article:Use of RNA interference to prevent lethal murine west nile virus infection.
Authors:Bai F, Wang T, Pal U, Bao F, Gould LH, Fikrig E.
Journal:J Infect Dis. 2005 Apr 1;191(7):1148-54. Epub 2005 Feb 23.
Entrez:15747251
siRNA sequence "guucaacucuacuggaugu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "guucaacucuacuggaugu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1968 " record
Length: 19
GC Content:42 %
Starting position: 189
Strain of Virus: 3a
GenBank Acc: HQ189126
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 189
Strain of Virus: 3a
GenBank Acc: HQ189126
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "guucaacucuacuggaugu" siRNA in Human Genome sequences
See HQ189126 at Genbank
Pubmed:21161551
Article:Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes.
Authors:Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S.
Journal:Arch Virol. 2011 Mar;156(3):433-42. Epub 2010 Dec 16.
Entrez:21161551
Article:Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes.
Authors:Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S.
Journal:Arch Virol. 2011 Mar;156(3):433-42. Epub 2010 Dec 16.
Entrez:21161551
siRNA sequence "cggcauacagcuucaacug" alignment with "St. Louis Encephalitis [SLE]" virus reference Genome sequences
siRNA sequence matching with "cggcauacagcuucaacug" St. Louis Encephalitis [SLE]" Virus reference Genome sequences
Browse all the records for "St. Louis Encephalitis [SLE]" virus
Browse "virsi1228 " record
Length: 19
GC Content:53 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 19
GC Content:53 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "cggcauacagcuucaacug" siRNA in Human Genome sequences
Pubmed:21423625
Article:Silencing early viral replication in macrophages and dendritic cells effectively suppresses flavivirus encephalitis.
Authors:Ye C, Abraham S, Wu H, Shankar P, Manjunath N.
Journal:PLoS One. 2011 Mar 15;6(3):e17889.
Entrez:21423625
Article:Silencing early viral replication in macrophages and dendritic cells effectively suppresses flavivirus encephalitis.
Authors:Ye C, Abraham S, Wu H, Shankar P, Manjunath N.
Journal:PLoS One. 2011 Mar 15;6(3):e17889.
Entrez:21423625
siRNA sequence "uacaccuccaccaaaacau" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "uacaccuccaccaaaacau" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1971 " record
Length: 19
GC Content:42 %
Starting position: 938
Strain of Virus: 3a
GenBank Acc: HQ189126
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 938
Strain of Virus: 3a
GenBank Acc: HQ189126
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "uacaccuccaccaaaacau" siRNA in Human Genome sequences
See HQ189126 at Genbank
Pubmed:21161551
Article:Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes.
Authors:Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S.
Journal:Arch Virol. 2011 Mar;156(3):433-42. Epub 2010 Dec 16.
Entrez:21161551
Article:Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes.
Authors:Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S.
Journal:Arch Virol. 2011 Mar;156(3):433-42. Epub 2010 Dec 16.
Entrez:21161551
siRNA sequence "caacugagcuugccauacu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "caacugagcuugccauacu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1970 " record
Length: 19
GC Content:47 %
Starting position: 875
Strain of Virus: 3a
GenBank Acc: HQ189126
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:47 %
Starting position: 875
Strain of Virus: 3a
GenBank Acc: HQ189126
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "caacugagcuugccauacu" siRNA in Human Genome sequences
See HQ189126 at Genbank
Pubmed:21161551
Article:Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes.
Authors:Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S.
Journal:Arch Virol. 2011 Mar;156(3):433-42. Epub 2010 Dec 16.
Entrez:21161551
Article:Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes.
Authors:Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S.
Journal:Arch Virol. 2011 Mar;156(3):433-42. Epub 2010 Dec 16.
Entrez:21161551
siRNA sequence "augaagagcaggacaaaag" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "augaagagcaggacaaaag" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi1502 " record
Length: 19
GC Content:42 %
GenBank Acc: NC_001474
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Length: 19
GC Content:42 %
GenBank Acc: NC_001474
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Offtargets for "augaagagcaggacaaaag" siRNA in Human Genome sequences
See NC_001474 at Genbank
Pubmed:20015996
Article:Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.
Authors:Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.
Journal:J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.
Entrez:20015996
Article:Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.
Authors:Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.
Journal:J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.
Entrez:20015996
siRNA sequence "gccuucacauucagaccuc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gccuucacauucagaccuc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1966 " record
Length: 19
GC Content:53 %
Starting position: 295
Strain of Virus: 3a
GenBank Acc: FJ790798
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:53 %
Starting position: 295
Strain of Virus: 3a
GenBank Acc: FJ790798
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gccuucacauucagaccuc" siRNA in Human Genome sequences
See FJ790798 at Genbank
Pubmed:21161551
Article:Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes.
Authors:Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S.
Journal:Arch Virol. 2011 Mar;156(3):433-42. Epub 2010 Dec 16.
Entrez:21161551
Article:Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes.
Authors:Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S.
Journal:Arch Virol. 2011 Mar;156(3):433-42. Epub 2010 Dec 16.
Entrez:21161551
siRNA sequence "gucgaguucauucgguaug" alignment with "Yellow Fever Virus" virus reference Genome sequences
siRNA sequence matching with "gucgaguucauucgguaug" Yellow Fever Virus" Virus reference Genome sequences
Browse all the records for "Yellow Fever Virus" virus
Browse "virsi2307 " record
Length: 19
GC Content:47 %
Strain of Virus: 17DD
GenBank Acc: NC_002031
Transfection Reagent: Lipofectamine 2000
Length: 19
GC Content:47 %
Strain of Virus: 17DD
GenBank Acc: NC_002031
Transfection Reagent: Lipofectamine 2000
Offtargets for "gucgaguucauucgguaug" siRNA in Human Genome sequences
See NC_002031 at Genbank
Pubmed:19169857
Article:RNA interference inhibits yellow fever virus replication in vitro and in vivo.
Authors:Pacca CC, Severino AA, Mondini A, Rahal P, D'avila SG, Cordeiro JA, Nogueira MC, Bronzoni RV, Nogueira ML.
Journal:Virus Genes. 2009 Apr;38(2):224-31. Epub 2009 Jan 25.
Entrez:19169857
Article:RNA interference inhibits yellow fever virus replication in vitro and in vivo.
Authors:Pacca CC, Severino AA, Mondini A, Rahal P, D'avila SG, Cordeiro JA, Nogueira MC, Bronzoni RV, Nogueira ML.
Journal:Virus Genes. 2009 Apr;38(2):224-31. Epub 2009 Jan 25.
Entrez:19169857
siRNA sequence "ggcucgaguauuguguacgag" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggcucgaguauuguguacgag" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2278 " record
Length: 21
GC Content:52 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48
Length: 21
GC Content:52 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48
Offtargets for "ggcucgaguauuguguacgag" siRNA in Human Genome sequences
See M62321 at Genbank
Pubmed:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893
siRNA sequence "ggagugucuggagcaacau" alignment with "West Nile Virus [WNV]" virus reference Genome sequences
siRNA sequence matching with "ggagugucuggagcaacau" West Nile Virus [WNV]" Virus reference Genome sequences
Browse all the records for "West Nile Virus [WNV]" virus
Browse "virsi1488 " record
Length: 19
GC Content:53 %
Starting position: 1005
Strain of Virus: NY99
GenBank Acc: NC_009942
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Length: 19
GC Content:53 %
Starting position: 1005
Strain of Virus: NY99
GenBank Acc: NC_009942
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):24
Offtargets for "ggagugucuggagcaacau" siRNA in Human Genome sequences
See NC_009942 at Genbank
Pubmed:18360908
Article:Inhibition of West Nile Virus replication by retrovirus-delivered small interfering RNA in human neuroblastoma cells.
Authors:Yang Y, Wu C, Wu J, Nerurkar VR, Yanagihara R, Lu Y.
Journal:J Med Virol. 2008 May;80(5):930-6.
Entrez:18360908
Article:Inhibition of West Nile Virus replication by retrovirus-delivered small interfering RNA in human neuroblastoma cells.
Authors:Yang Y, Wu C, Wu J, Nerurkar VR, Yanagihara R, Lu Y.
Journal:J Med Virol. 2008 May;80(5):930-6.
Entrez:18360908
siRNA sequence "ugacaaacgugcugaccca" alignment with "West Nile Virus [WNV]" virus reference Genome sequences
siRNA sequence matching with "ugacaaacgugcugaccca" West Nile Virus [WNV]" Virus reference Genome sequences
Browse all the records for "West Nile Virus [WNV]" virus
Browse "virsi1492 " record
Length: 19
GC Content:53 %
Starting position: 246
Strain of Virus: WNV Isolate 2471
GenBank Acc: HA063760
Transfection Reagent: siPORT Amine/Lipid
Incubation Time (Hours):24
Length: 19
GC Content:53 %
Starting position: 246
Strain of Virus: WNV Isolate 2471
GenBank Acc: HA063760
Transfection Reagent: siPORT Amine/Lipid
Incubation Time (Hours):24
Offtargets for "ugacaaacgugcugaccca" siRNA in Human Genome sequences
See HA063760 at Genbank
Pubmed:15747251
Article:Use of RNA interference to prevent lethal murine west nile virus infection.
Authors:Bai F, Wang T, Pal U, Bao F, Gould LH, Fikrig E.
Journal:J Infect Dis. 2005 Apr 1;191(7):1148-54. Epub 2005 Feb 23.
Entrez:15747251
Article:Use of RNA interference to prevent lethal murine west nile virus infection.
Authors:Bai F, Wang T, Pal U, Bao F, Gould LH, Fikrig E.
Journal:J Infect Dis. 2005 Apr 1;191(7):1148-54. Epub 2005 Feb 23.
Entrez:15747251
siRNA sequence "uggcuugggauaugaugau" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "uggcuugggauaugaugau" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1967 " record
Length: 19
GC Content:42 %
Starting position: 550
Strain of Virus: 3a
GenBank Acc: FJ790798
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 550
Strain of Virus: 3a
GenBank Acc: FJ790798
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "uggcuugggauaugaugau" siRNA in Human Genome sequences
See FJ790798 at Genbank
Pubmed:21161551
Article:Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes.
Authors:Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S.
Journal:Arch Virol. 2011 Mar;156(3):433-42. Epub 2010 Dec 16.
Entrez:21161551
Article:Inhibition of hepatitis C virus genotype 3a by siRNAs targeting envelope genes.
Authors:Khaliq S, Jahan S, Ijaz B, Ahmad W, Asad S, Hassan S.
Journal:Arch Virol. 2011 Mar;156(3):433-42. Epub 2010 Dec 16.
Entrez:21161551
siRNA sequence "gcugcgugacuaucauguc" alignment with "West Nile Virus [WNV]" virus reference Genome sequences
siRNA sequence matching with "gcugcgugacuaucauguc" West Nile Virus [WNV]" Virus reference Genome sequences
Browse all the records for "West Nile Virus [WNV]" virus
Browse "virsi2204 " record
Length: 19
GC Content:53 %
Strain of Virus: Isolate 2741
GenBank Acc: AF206518
Incubation Time (Hours):24
Length: 19
GC Content:53 %
Strain of Virus: Isolate 2741
GenBank Acc: AF206518
Incubation Time (Hours):24
Offtargets for "gcugcgugacuaucauguc" siRNA in Human Genome sequences
See AF206518 at Genbank
Pubmed:19135091
Article:Effective siRNA targeting of the 3' untranslated region of the West Nile virus genome.
Authors:Anthony KG, Bai F, Krishnan MN, Fikrig E, Koski RA.
Journal:Antiviral Res. 2009 Jun;82(3):166-8. Epub 2009 Jan 7.
Entrez:19135091
Article:Effective siRNA targeting of the 3' untranslated region of the West Nile virus genome.
Authors:Anthony KG, Bai F, Krishnan MN, Fikrig E, Koski RA.
Journal:Antiviral Res. 2009 Jun;82(3):166-8. Epub 2009 Jan 7.
Entrez:19135091
Virus_Name
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm