Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for NS5B are 14
Results from 0 - 25
siRNA sequence "gacacugagacaccaauugac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gacacugagacaccaauugac" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1985 " record
Length: 21
GC Content:48 %
Starting position: 6379
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 6379
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "gacacugagacaccaauugac" siRNA in Human Genome sequences
See AJ242654 at Genbank
Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
siRNA sequence "ggaugauccugaugacucauu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggaugauccugaugacucauu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1986 " record
Length: 21
GC Content:43 %
Starting position: 7259
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 7259
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "ggaugauccugaugacucauu" siRNA in Human Genome sequences
See AJ242654 at Genbank
Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
siRNA sequence "uguggugccuacuccuacuuu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "uguggugccuacuccuacuuu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1987 " record
Length: 21
GC Content:48 %
Starting position: 7712
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 7712
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "uguggugccuacuccuacuuu" siRNA in Human Genome sequences
See AJ242654 at Genbank
Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
siRNA sequence "gggcagaacugcggcuaucgc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gggcagaacugcggcuaucgc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2152 " record
Length: 21
GC Content:67 %
GenBank Acc: nM_012526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 21
GC Content:67 %
GenBank Acc: nM_012526
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gggcagaacugcggcuaucgc" siRNA in Human Genome sequences
See nM_012526 at Genbank
Pubmed:12594341
Article:RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Authors:Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
Journal:Proc Natl Acad Sci U S A. 2003 Mar 4;100(5):2783-8. Epub 2003 Feb 19.
Entrez:12594341
Article:RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Authors:Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
Journal:Proc Natl Acad Sci U S A. 2003 Mar 4;100(5):2783-8. Epub 2003 Feb 19.
Entrez:12594341
siRNA sequence "gacacugagacaccaauugac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2354 " record
Length: 21
GC Content:48 %
Starting position: 7982
GenBank Acc: HQ908359
Transfection Reagent: Electroporation
Length: 21
GC Content:48 %
Starting position: 7982
GenBank Acc: HQ908359
Transfection Reagent: Electroporation
Offtargets for "gacacugagacaccaauugac" siRNA in Human Genome sequences
See HQ908359 at Genbank
Pubmed:15890944
Article:Hepatitis C virus replicons escape RNA interference induced by a short interfering RNA directed against the NS5b coding region.
Authors:Wilson JA, Richardson CD.
Journal:J Virol. 2005 Jun;79(11):7050-8.
Entrez:15890944
Article:Hepatitis C virus replicons escape RNA interference induced by a short interfering RNA directed against the NS5b coding region.
Authors:Wilson JA, Richardson CD.
Journal:J Virol. 2005 Jun;79(11):7050-8.
Entrez:15890944
siRNA sequence "gacacugagacaccaauugac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi3001 " record
Length: 21
GC Content:48 %
Starting position: 7982
GenBank Acc: HQ908359
Transfection Reagent: Electroporation
Length: 21
GC Content:48 %
Starting position: 7982
GenBank Acc: HQ908359
Transfection Reagent: Electroporation
Offtargets for "gacacugagacaccaauugac" siRNA in Human Genome sequences
See HQ908359 at Genbank
Pubmed:15890944
Article:Hepatitis C virus replicons escape RNA interference induced by a short interfering RNA directed against the NS5b coding region.
Authors:Wilson JA, Richardson CD.
Journal:J Virol. 2005 Jun;79(11):7050-8.
Entrez:15890944
Article:Hepatitis C virus replicons escape RNA interference induced by a short interfering RNA directed against the NS5b coding region.
Authors:Wilson JA, Richardson CD.
Journal:J Virol. 2005 Jun;79(11):7050-8.
Entrez:15890944
siRNA sequence "ggagaugaaggcgaaggcguc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggagaugaaggcgaaggcguc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2150 " record
Length: 21
GC Content:62 %
GenBank Acc: nM_005922
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 21
GC Content:62 %
GenBank Acc: nM_005922
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "ggagaugaaggcgaaggcguc" siRNA in Human Genome sequences
See nM_005922 at Genbank
Pubmed:12594341
Article:RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Authors:Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
Journal:Proc Natl Acad Sci U S A. 2003 Mar 4;100(5):2783-8. Epub 2003 Feb 19.
Entrez:12594341
Article:RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Authors:Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
Journal:Proc Natl Acad Sci U S A. 2003 Mar 4;100(5):2783-8. Epub 2003 Feb 19.
Entrez:12594341
siRNA sequence "gacacugagacaccaauugac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gacacugagacaccaauugac" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2151 " record
Length: 21
GC Content:48 %
GenBank Acc: nM_021655
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 21
GC Content:48 %
GenBank Acc: nM_021655
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gacacugagacaccaauugac" siRNA in Human Genome sequences
See nM_021655 at Genbank
Pubmed:12594341
Article:RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Authors:Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
Journal:Proc Natl Acad Sci U S A. 2003 Mar 4;100(5):2783-8. Epub 2003 Feb 19.
Entrez:12594341
Article:RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Authors:Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
Journal:Proc Natl Acad Sci U S A. 2003 Mar 4;100(5):2783-8. Epub 2003 Feb 19.
Entrez:12594341
siRNA sequence "gacacugagacaccaauugac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gacacugagacaccaauugac" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Offtargets for "gacacugagacaccaauugac" siRNA in Human Genome sequences
Pubmed:16872906
Article:Simultaneous targeting of HCV replication and viral binding with a single lentiviral vector containing multiple RNA interference expression cassettes.
Authors:Henry SD, van der Wegen P, Metselaar HJ, Tilanus HW, Scholte BJ, van der Laan LJ.
Journal:Mol Ther. 2006 Oct;14(4):485-93. Epub 2006 Jul 26.
Entrez:16872906
Article:Simultaneous targeting of HCV replication and viral binding with a single lentiviral vector containing multiple RNA interference expression cassettes.
Authors:Henry SD, van der Wegen P, Metselaar HJ, Tilanus HW, Scholte BJ, van der Laan LJ.
Journal:Mol Ther. 2006 Oct;14(4):485-93. Epub 2006 Jul 26.
Entrez:16872906
siRNA sequence "ccagaauacgacuuggagc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ccagaauacgacuuggagc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1181 " record
Length: 19
GC Content:53 %
Starting position: 8666
Strain of Virus: Genotype 1a
Incubation Time (Hours):72
Length: 19
GC Content:53 %
Starting position: 8666
Strain of Virus: Genotype 1a
Incubation Time (Hours):72
Offtargets for "ccagaauacgacuuggagc" siRNA in Human Genome sequences
Pubmed:15977238
Article:Small interfering RNA effectively inhibits protein expression and negative strand RNA synthesis from a full-length hepatitis C virus clone.
Authors:Prabhu R, Vittal P, Yin Q, Flemington E, Garry R, Robichaux WH, Dash S.
Journal:J Med Virol. 2005 Aug;76(4):511-9.
Entrez:15977238
Article:Small interfering RNA effectively inhibits protein expression and negative strand RNA synthesis from a full-length hepatitis C virus clone.
Authors:Prabhu R, Vittal P, Yin Q, Flemington E, Garry R, Robichaux WH, Dash S.
Journal:J Med Virol. 2005 Aug;76(4):511-9.
Entrez:15977238
siRNA sequence "ggaugauccugaugacuca" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggaugauccugaugacuca" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1974 " record
Length: 19
GC Content:47 %
Starting position: 1265
Strain of Virus: Genotype 1b
GenBank Acc: HQ641456
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):48
Length: 19
GC Content:47 %
Starting position: 1265
Strain of Virus: Genotype 1b
GenBank Acc: HQ641456
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):48
Offtargets for "ggaugauccugaugacuca" siRNA in Human Genome sequences
See HQ641456 at Genbank
Pubmed:20464448
Article:Comparative analysis of intracellular inhibition of hepatitis C virus replication by small interfering RNAs.
Authors:Chang B, Lee CH, Lee JH, Lee SW.
Journal:Biotechnol Lett. 2010 Sep;32(9):1231-7. Epub 2010 May 13.
Entrez:20464448
Article:Comparative analysis of intracellular inhibition of hepatitis C virus replication by small interfering RNAs.
Authors:Chang B, Lee CH, Lee JH, Lee SW.
Journal:Biotechnol Lett. 2010 Sep;32(9):1231-7. Epub 2010 May 13.
Entrez:20464448
siRNA sequence "aagccagcucgccuuaucgua" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "aagccagcucgccuuaucgua" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2141 " record
Length: 21
GC Content:52 %
Starting position: 11196
Strain of Virus: Isolate Con1
GenBank Acc: AJ238799
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 21
GC Content:52 %
Starting position: 11196
Strain of Virus: Isolate Con1
GenBank Acc: AJ238799
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "aagccagcucgccuuaucgua" siRNA in Human Genome sequences
See AJ238799 at Genbank
Pubmed:16979254
Article:Inhibition of hepatitis C virus gene expression by small interfering RNAs using a tri-cistronic full-length viral replicon and a transient mouse model.
Authors:Kim M, Shin D, Kim SI, Park M.
Journal:Virus Res. 2006 Dec;122(1-2):1-10. Epub 2006 Sep 15.
Entrez:16979254
Article:Inhibition of hepatitis C virus gene expression by small interfering RNAs using a tri-cistronic full-length viral replicon and a transient mouse model.
Authors:Kim M, Shin D, Kim SI, Park M.
Journal:Virus Res. 2006 Dec;122(1-2):1-10. Epub 2006 Sep 15.
Entrez:16979254
siRNA sequence "aacggggagcuaaacacucca" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "aacggggagcuaaacacucca" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2142 " record
Length: 21
GC Content:52 %
Starting position: 12509
Strain of Virus: Isolate Con1
GenBank Acc: AJ238799
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 21
GC Content:52 %
Starting position: 12509
Strain of Virus: Isolate Con1
GenBank Acc: AJ238799
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "aacggggagcuaaacacucca" siRNA in Human Genome sequences
See AJ238799 at Genbank
Pubmed:16979254
Article:Inhibition of hepatitis C virus gene expression by small interfering RNAs using a tri-cistronic full-length viral replicon and a transient mouse model.
Authors:Kim M, Shin D, Kim SI, Park M.
Journal:Virus Res. 2006 Dec;122(1-2):1-10. Epub 2006 Sep 15.
Entrez:16979254
Article:Inhibition of hepatitis C virus gene expression by small interfering RNAs using a tri-cistronic full-length viral replicon and a transient mouse model.
Authors:Kim M, Shin D, Kim SI, Park M.
Journal:Virus Res. 2006 Dec;122(1-2):1-10. Epub 2006 Sep 15.
Entrez:16979254
siRNA sequence "ugucagaucuacggggcu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ugucagaucuacggggcu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1975 " record
Length: 18
GC Content:56 %
Starting position: 592
Strain of Virus: Genotype 1b
GenBank Acc: GQ285029
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):48
Length: 18
GC Content:56 %
Starting position: 592
Strain of Virus: Genotype 1b
GenBank Acc: GQ285029
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):48
Offtargets for "ugucagaucuacggggcu" siRNA in Human Genome sequences
See GQ285029 at Genbank
Pubmed:20464448
Article:Comparative analysis of intracellular inhibition of hepatitis C virus replication by small interfering RNAs.
Authors:Chang B, Lee CH, Lee JH, Lee SW.
Journal:Biotechnol Lett. 2010 Sep;32(9):1231-7. Epub 2010 May 13.
Entrez:20464448
Article:Comparative analysis of intracellular inhibition of hepatitis C virus replication by small interfering RNAs.
Authors:Chang B, Lee CH, Lee JH, Lee SW.
Journal:Biotechnol Lett. 2010 Sep;32(9):1231-7. Epub 2010 May 13.
Entrez:20464448
Virus_Name
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm