VIRsiRNAdb

Browse BY

Family of Virus

Virus Name

Gene Name

Pubmed Id

VsiRNAid

Total number of Results for

P/S

Results from

0 - 25

siRNA sequence "cauggagagcacaacauca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "cauggagagcacaacauca" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1460 " record
Length: 19
GC Content:47 %
Starting position: 157
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "cauggagagcacaacauca" siRNA in Human Genome sequences

See at Genbank

Pubmed:14592428
Article:Inhibition of hepatitis B virus replication by stably expressed shRNA.
Authors:Chen Y, Du D, Wu J, Chan CP, Tan Y, Kung HF, He ML.
Journal:Biochem Biophys Res Commun. 2003 Nov 14;311(2):398-404.
Entrez:14592428

siRNA sequence "cucaguuuacuagugccauuuguuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "cucaguuuacuagugccauuuguuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1153 " record
Length: 25
GC Content:40 %
Starting position: 516

Offtargets for "cucaguuuacuagugccauuuguuc" siRNA in Human Genome sequences

See at Genbank

Pubmed:16900331
Article:A retrovirus-based system to stably silence hepatitis B virus genes by RNA interference.
Authors:Jia F, Zhang YZ, Liu CM.
Journal:Biotechnol Lett. 2006 Oct;28(20):1679-85. Epub 2006 Aug 10.
Entrez:16900331

siRNA sequence "guuauauggaugauguggu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "guuauauggaugauguggu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1463 " record
Length: 19
GC Content:37 %
Starting position: 736
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "guuauauggaugauguggu" siRNA in Human Genome sequences

See at Genbank

siRNA sequence "caucacaucaggauuccua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "caucacaucaggauuccua" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1152 " record
Length: 19
GC Content:42 %
Starting position: 9

Offtargets for "caucacaucaggauuccua" siRNA in Human Genome sequences

See at Genbank

siRNA sequence "cucaguuuacuagugccauuuguuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "cucaguuuacuagugccauuuguuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1469 " record
Length: 25
GC Content:40 %
Incubation Time (Hours):192

Offtargets for "cucaguuuacuagugccauuuguuc" siRNA in Human Genome sequences

See at Genbank

Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585

siRNA sequence "cguuucuccuggcucaguu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "cguuucuccuggcucaguu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1462 " record
Length: 19
GC Content:53 %
Starting position: 660
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "cguuucuccuggcucaguu" siRNA in Human Genome sequences

See at Genbank

siRNA sequence "uccugcugcuaugccucau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "uccugcugcuaugccucau" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1043 " record
Length: 19
GC Content:53 %
Starting position: 413
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "uccugcugcuaugccucau" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:17596868
Article:Targeted inhibition of HBV gene expression by single-chain antibody mediated small interfering RNA delivery.
Authors:Wen WH, Liu JY, Qin WJ, Zhao J, Wang T, Jia LT, Meng YL, Gao H, Xue CF, Jin BQ, Yao LB, Chen SY, Yang AG.
Journal:Hepatology. 2007 Jul;46(1):84-94.
Entrez:17596868

siRNA sequence "uucgcaguccccaaccucc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "uucgcaguccccaaccucc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1136 " record
Length: 19
GC Content:63 %
Starting position: 310
Strain of Virus: adr
GenBank Acc: AF286594
Transfection Reagent: FuGENE 6 Cationic Liposome
Incubation Time (Hours):72

Offtargets for "uucgcaguccccaaccucc" siRNA in Human Genome sequences

See AF286594 at Genbank

Pubmed:15378775
Article:siRNA-mediated inhibition of HBV replication and expression.
Authors:Zhang XN, Xiong W, Wang JD, Hu YW, Xiang L, Yuan ZH.
Journal:World J Gastroenterol. 2004 Oct 15;10(20):2967-71.
Entrez:15378775

siRNA sequence "augaugugguauugggggccaaguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "augaugugguauugggggccaaguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1471 " record
Length: 25
GC Content:52 %
Incubation Time (Hours):192

Offtargets for "augaugugguauugggggccaaguc" siRNA in Human Genome sequences

See at Genbank

siRNA sequence "uggccaaaauucgcaguccccaacc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "uggccaaaauucgcaguccccaacc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1472 " record
Length: 25
GC Content:56 %
Incubation Time (Hours):192

Offtargets for "uggccaaaauucgcaguccccaacc" siRNA in Human Genome sequences

See at Genbank

siRNA sequence "gacuaccaagguauguugc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gacuaccaagguauguugc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1461 " record
Length: 19
GC Content:47 %
Starting position: 451
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gacuaccaagguauguugc" siRNA in Human Genome sequences

See at Genbank

siRNA sequence "gccucaucuucuuguuggu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gccucaucuucuuguuggu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1117 " record
Length: 19
GC Content:47 %
Starting position: 424
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gccucaucuucuuguuggu" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "gcucaguuuacuagugccauu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gcucaguuuacuagugccauu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1120 " record
Length: 21
GC Content:43 %
Starting position: 672
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcucaguuuacuagugccauu" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "aauaccgcagagucuagacuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "aauaccgcagagucuagacuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1114 " record
Length: 21
GC Content:48 %
Starting position: 237
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aauaccgcagagucuagacuc" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "ggcucaguuuacuagugcc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ggcucaguuuacuagugcc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1041 " record
Length: 19
GC Content:53 %
Starting position: 671
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "ggcucaguuuacuagugcc" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "gugguggacuucucucaau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gugguggacuucucucaau" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1115 " record
Length: 19
GC Content:47 %
Starting position: 257
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gugguggacuucucucaau" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "gcucaaggaaccucuaugu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gcucaaggaaccucuaugu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1119 " record
Length: 19
GC Content:47 %
Starting position: 537
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcucaaggaaccucuaugu" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "gauuccuaggaccccuucucg" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "gauuccuaggaccccuucucg" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1477 " record
Length: 21
GC Content:57 %
Starting position: 176
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):96

Offtargets for "gauuccuaggaccccuucucg" siRNA in Human Genome sequences

See U95551 at Genbank

Pubmed:15850463
Article:Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA.
Authors:Ren XR, Zhou LJ, Luo GB, Lin B, Xu A.
Journal:J Viral Hepat. 2005 May;12(3):236-42.
Entrez:15850463

siRNA sequence "auguugcccguuuguccucua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "auguugcccguuuguccucua" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1118 " record
Length: 21
GC Content:48 %
Starting position: 463
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "auguugcccguuuguccucua" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "ucacucaccaaccuccugu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "ucacucaccaaccuccugu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1116 " record
Length: 19
GC Content:53 %
Starting position: 333
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ucacucaccaaccuccugu" siRNA in Human Genome sequences

See U95551 at Genbank

siRNA sequence "uaugguuuugggggccaaguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences

siRNA sequence matching with "uaugguuuugggggccaaguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus

Browse "virsi1121 " record
Length: 21
GC Content:52 %
Starting position: 748
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "uaugguuuugggggccaaguc" siRNA in Human Genome sequences

See U95551 at Genbank

VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With
virsi1460	cauggagagcacaacauca	Hepatitis B Virus [HBV]	P/S	HepG2	RNA	98	14592428	Blast SL	refseqs
virsi1153	cucaguuuacuagugccauuuguuc	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	97	16900331	Blast SL	refseqs
virsi1463	guuauauggaugauguggu	Hepatitis B Virus [HBV]	P/S	HepG2	RNA	97	14592428	Blast SL	refseqs
virsi1152	caucacaucaggauuccua	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	95	16900331	Blast SL	refseqs
virsi1469	cucaguuuacuagugccauuuguuc	Hepatitis B Virus [HBV]	P/S	Huh-7	Protein	94	12740585	Blast SL	refseqs
virsi1462	cguuucuccuggcucaguu	Hepatitis B Virus [HBV]	P/S	HepG2	RNA	93	14592428	Blast SL	refseqs
virsi1043	uccugcugcuaugccucau	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	88	17596868	Blast SL	refseqs
virsi1136	uucgcaguccccaaccucc	Hepatitis B Virus [HBV]	P/S	Huh-7	Protein	86	15378775	Blast SL	refseqs
virsi1471	augaugugguauugggggccaaguc	Hepatitis B Virus [HBV]	P/S	Huh-7	Protein	83	12740585	Blast SL	refseqs
virsi1472	uggccaaaauucgcaguccccaacc	Hepatitis B Virus [HBV]	P/S	Huh-7	Protein	80	12740585	Blast SL	refseqs
virsi1461	gacuaccaagguauguugc	Hepatitis B Virus [HBV]	P/S	HepG2	RNA	76	14592428	Blast SL	refseqs
virsi1117	gccucaucuucuuguuggu	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	73	19026173	Blast SL	refseqs
virsi1120	gcucaguuuacuagugccauu	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	73	19026173	Blast SL	refseqs
virsi1114	aauaccgcagagucuagacuc	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	72	19026173	Blast SL	refseqs
virsi1041	ggcucaguuuacuagugcc	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	72	17596868	Blast SL	refseqs
virsi1115	gugguggacuucucucaau	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	70	19026173	Blast SL	refseqs
virsi1119	gcucaaggaaccucuaugu	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	65	19026173	Blast SL	refseqs
virsi1477	gauuccuaggaccccuucucg	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	60	15850463	Blast SL	refseqs
virsi1118	auguugcccguuuguccucua	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	54	19026173	Blast SL	refseqs
virsi1116	ucacucaccaaccuccugu	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	52	19026173	Blast SL	refseqs
virsi1121	uaugguuuugggggccaaguc	Hepatitis B Virus [HBV]	P/S	HepG2.2.15	Protein	35	19026173	Blast SL	refseqs

: siRNA seedlocator algorithm

VIRsiRNAdb

Database of Viral siRNA / shRNA

Browse BY