VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Env are 16
Results from 0 - 25

siRNA sequence "aaggaguuccugaucuucuggu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aaggaguuccugaucuucuggu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1295 " record
Length: 22
GC Content:45 %
Starting position: 269
Strain of Virus: TW-PH2_SC27 Isolate
GenBank Acc: AY451891
Transfection Reagent: FuGENE
Incubation Time (Hours):48

Offtargets for "aaggaguuccugaucuucuggu" siRNA in Human Genome sequences
See AY451891 at Genbank
Pubmed:16757801
Article:Identification of effective siRNA blocking the expression of SARS viral envelope E and RDRP genes.
Authors:Meng B, Lui YW, Meng S, Cao C, Hu Y.
Journal:Mol Biotechnol. 2006 Jun;33(2):141-8.
Entrez:16757801

siRNA sequence "aaaccaacgguuuacgucuac" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aaaccaacgguuuacgucuac" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1300 " record
Length: 21
GC Content:43 %
Starting position: 220
Strain of Virus: TW-PH2_SC27 Isolate
GenBank Acc: AY451891
Transfection Reagent: FuGENE
Incubation Time (Hours):48

Offtargets for "aaaccaacgguuuacgucuac" siRNA in Human Genome sequences
See AY451891 at Genbank
Pubmed:16757801
Article:Identification of effective siRNA blocking the expression of SARS viral envelope E and RDRP genes.
Authors:Meng B, Lui YW, Meng S, Cao C, Hu Y.
Journal:Mol Biotechnol. 2006 Jun;33(2):141-8.
Entrez:16757801

siRNA sequence "gaucuucuggucuaaacga" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "gaucuucuggucuaaacga" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1302 " record
Length: 19
GC Content:42 %
Starting position: 26333
Transfection Reagent: Sofast
Incubation Time (Hours):24

Offtargets for "gaucuucuggucuaaacga" siRNA in Human Genome sequences
See at Genbank
Pubmed:17139181
Article:Inhibition of SARS-CoV gene expression by adenovirus-delivered small hairpin RNA.
Authors:Zhang X, Wu K, Yue X, Zhu Y, Wu J.
Journal:Intervirology. 2007;50(2):63-70. Epub 2006 Nov 30.
Entrez:17139181

siRNA sequence "gaucuucuggucuaaacga" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "gaucuucuggucuaaacga" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1317 " record
Length: 19
GC Content:42 %
Starting position: 26333
Transfection Reagent: Sofast
Incubation Time (Hours):24

Offtargets for "gaucuucuggucuaaacga" siRNA in Human Genome sequences
See at Genbank
Pubmed:17139181
Article:Inhibition of SARS-CoV gene expression by adenovirus-delivered small hairpin RNA.
Authors:Zhang X, Wu K, Yue X, Zhu Y, Wu J.
Journal:Intervirology. 2007;50(2):63-70. Epub 2006 Nov 30.
Entrez:17139181

siRNA sequence "cguuucggaagaaacagguac" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "cguuucggaagaaacagguac" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1336 " record
Length: 21
GC Content:48 %
Starting position: 26113
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "cguuucggaagaaacagguac" siRNA in Human Genome sequences
See AY304495 at Genbank
Pubmed:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566

siRNA sequence "ugaaggaguuccugaucuucu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "ugaaggaguuccugaucuucu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1395 " record
Length: 21
GC Content:43 %
Starting position: 26320
GenBank Acc: NC_004722
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ugaaggaguuccugaucuucu" siRNA in Human Genome sequences
See NC_004722 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182

siRNA sequence "aacgguuuacgucuacucgcg" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aacgguuuacgucuacucgcg" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1394 " record
Length: 21
GC Content:52 %
Starting position: 26278
GenBank Acc: NC_004721
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aacgguuuacgucuacucgcg" siRNA in Human Genome sequences
See NC_004721 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182

siRNA sequence "gcguguuaaaaaucugaac" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "gcguguuaaaaaucugaac" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1306 " record
Length: 19
GC Content:37 %
Starting position: 26296
Transfection Reagent: Sofast
Incubation Time (Hours):24

Offtargets for "gcguguuaaaaaucugaac" siRNA in Human Genome sequences
See at Genbank
Pubmed:17139181
Article:Inhibition of SARS-CoV gene expression by adenovirus-delivered small hairpin RNA.
Authors:Zhang X, Wu K, Yue X, Zhu Y, Wu J.
Journal:Intervirology. 2007;50(2):63-70. Epub 2006 Nov 30.
Entrez:17139181

siRNA sequence "uuucgugguauucuugcuagu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "uuucgugguauucuugcuagu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1447 " record
Length: 21
GC Content:38 %
Starting position: 26182
GenBank Acc: NC_004719
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "uuucgugguauucuugcuagu" siRNA in Human Genome sequences
See NC_004719 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182

siRNA sequence "uuaauaguuaauagcguacuu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "uuaauaguuaauagcguacuu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1997 " record
Length: 21
GC Content:24 %
Starting position: 26150
GenBank Acc: NC_004718
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "uuaauaguuaauagcguacuu" siRNA in Human Genome sequences
See NC_004718 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182

siRNA sequence "guaaaaccaacgguuuacg" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "guaaaaccaacgguuuacg" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1305 " record
Length: 19
GC Content:42 %
Starting position: 26270
Transfection Reagent: Sofast
Incubation Time (Hours):24

Offtargets for "guaaaaccaacgguuuacg" siRNA in Human Genome sequences
See at Genbank
Pubmed:17139181
Article:Inhibition of SARS-CoV gene expression by adenovirus-delivered small hairpin RNA.
Authors:Zhang X, Wu K, Yue X, Zhu Y, Wu J.
Journal:Intervirology. 2007;50(2):63-70. Epub 2006 Nov 30.
Entrez:17139181

siRNA sequence "agcaguacgcacacaaucgaa" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "agcaguacgcacacaaucgaa" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1397 " record
Length: 21
GC Content:48 %
Starting position: 26226
GenBank Acc: NC_004720
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "agcaguacgcacacaaucgaa" siRNA in Human Genome sequences
See NC_004720 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182

siRNA sequence "gcguguuaaaaaucugaac" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "gcguguuaaaaaucugaac" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1320 " record
Length: 19
GC Content:37 %
Starting position: 26296
Transfection Reagent: Sofast
Incubation Time (Hours):24

Offtargets for "gcguguuaaaaaucugaac" siRNA in Human Genome sequences
See at Genbank
Pubmed:17139181
Article:Inhibition of SARS-CoV gene expression by adenovirus-delivered small hairpin RNA.
Authors:Zhang X, Wu K, Yue X, Zhu Y, Wu J.
Journal:Intervirology. 2007;50(2):63-70. Epub 2006 Nov 30.
Entrez:17139181

siRNA sequence "gaacucuucugaaggaguu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "gaacucuucugaaggaguu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1301 " record
Length: 19
GC Content:42 %
Starting position: 26311
Transfection Reagent: Sofast
Incubation Time (Hours):24

Offtargets for "gaacucuucugaaggaguu" siRNA in Human Genome sequences
See at Genbank
Pubmed:17139181
Article:Inhibition of SARS-CoV gene expression by adenovirus-delivered small hairpin RNA.
Authors:Zhang X, Wu K, Yue X, Zhu Y, Wu J.
Journal:Intervirology. 2007;50(2):63-70. Epub 2006 Nov 30.
Entrez:17139181

siRNA sequence "gaacucuucugaaggaguu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "gaacucuucugaaggaguu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1319 " record
Length: 19
GC Content:42 %
Starting position: 26311
Transfection Reagent: Sofast
Incubation Time (Hours):24

Offtargets for "gaacucuucugaaggaguu" siRNA in Human Genome sequences
See at Genbank
Pubmed:17139181
Article:Inhibition of SARS-CoV gene expression by adenovirus-delivered small hairpin RNA.
Authors:Zhang X, Wu K, Yue X, Zhu Y, Wu J.
Journal:Intervirology. 2007;50(2):63-70. Epub 2006 Nov 30.
Entrez:17139181

siRNA sequence "guaaaaccaacgguuuacg" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "guaaaaccaacgguuuacg" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1321 " record
Length: 19
GC Content:42 %
Starting position: 26270
Transfection Reagent: Sofast
Incubation Time (Hours):24

Offtargets for "guaaaaccaacgguuuacg" siRNA in Human Genome sequences
See at Genbank
Pubmed:17139181
Article:Inhibition of SARS-CoV gene expression by adenovirus-delivered small hairpin RNA.
Authors:Zhang X, Wu K, Yue X, Zhu Y, Wu J.
Journal:Intervirology. 2007;50(2):63-70. Epub 2006 Nov 30.
Entrez:17139181


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1295	aaggaguuccugaucuucuggu	SARS Coronavirus	Env	NIH 3T3	mRNA	97	16757801	Blast SL	refseqs
virsi1300	aaaccaacgguuuacgucuac	SARS Coronavirus	Env	NIH 3T3	mRNA	89	16757801	Blast SL	refseqs
virsi1302	gaucuucuggucuaaacga	SARS Coronavirus	Env	COS-7	Protein	84	17139181	Blast SL	refseqs
virsi1317	gaucuucuggucuaaacga	SARS Coronavirus	Env	293T	Protein	79	17139181	Blast SL	refseqs
virsi1336	cguuucggaagaaacagguac	SARS Coronavirus	Env	FRhK-4	RNA	74	16638566	Blast SL	refseqs
virsi1395	ugaaggaguuccugaucuucu	SARS Coronavirus	Env	Vero E6	mRNA	70	15780182	Blast SL	refseqs
virsi1394	aacgguuuacgucuacucgcg	SARS Coronavirus	Env	Vero E6	mRNA	51	15780182	Blast SL	refseqs
virsi1306	gcguguuaaaaaucugaac	SARS Coronavirus	Env	COS-7	Protein	35	17139181	Blast SL	refseqs
virsi1447	uuucgugguauucuugcuagu	SARS Coronavirus	Env	Vero E6	mRNA	26	15780182	Blast SL	refseqs
virsi1997	uuaauaguuaauagcguacuu	SARS Coronavirus	Env	Vero E6	mRNA	26	15780182	Blast SL	refseqs
virsi1305	guaaaaccaacgguuuacg	SARS Coronavirus	Env	COS-7	Protein	23	17139181	Blast SL	refseqs
virsi1397	agcaguacgcacacaaucgaa	SARS Coronavirus	Env	Vero E6	mRNA	21	15780182	Blast SL	refseqs
virsi1320	gcguguuaaaaaucugaac	SARS Coronavirus	Env	293T	Protein	15	17139181	Blast SL	refseqs
virsi1301	gaacucuucugaaggaguu	SARS Coronavirus	Env	COS-7	Protein	14	17139181	Blast SL	refseqs
virsi1319	gaacucuucugaaggaguu	SARS Coronavirus	Env	293T	Protein	12	17139181	Blast SL	refseqs
virsi1321	guaaaaccaacgguuuacg	SARS Coronavirus	Env	293T	Protein	2	17139181	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm