VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for X are 46
Results from 0 - 25

« previous12next »
siRNA sequence "gaggacucuuggacucucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaggacucuuggacucucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1672 " record
Length: 19
GC Content:53 %
Starting position: 1660
Strain of Virus: adw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000

Offtargets for "gaggacucuuggacucucu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16353167
Article:Knock-down of hepatitis B virus X protein reduces the tumorigenicity of hepatocellular carcinoma cells.
Authors:Chan DW, Ng IO.
Journal:J Pathol. 2006 Feb;208(3):372-80.
Entrez:16353167

siRNA sequence "gagcacucuuggacucuca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gagcacucuuggacucuca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1674 " record
Length: 19
GC Content:53 %
Starting position: 258
Strain of Virus: adr
GenBank Acc: M38454
Transfection Reagent: Lipofectamine 2000

Offtargets for "gagcacucuuggacucuca" siRNA in Human Genome sequences
See M38454 at Genbank
Pubmed:16353167
Article:Knock-down of hepatitis B virus X protein reduces the tumorigenicity of hepatocellular carcinoma cells.
Authors:Chan DW, Ng IO.
Journal:J Pathol. 2006 Feb;208(3):372-80.
Entrez:16353167

siRNA sequence "cgaccuugaggcauacuuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cgaccuugaggcauacuuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1963 " record
Length: 19
GC Content:53 %
Starting position: 1691
GenBank Acc: GU563560
Transfection Reagent: Lipofectamine 2000

Offtargets for "cgaccuugaggcauacuuc" siRNA in Human Genome sequences
See GU563560 at Genbank
Pubmed:21107751
Article:Dysregulation of β-catenin by hepatitis B virus X protein in HBV-infected human hepatocellular carcinomas.
Authors:Chen L, Hu L, Li L, Liu Y, Tu QQ, Chang YX, Yan HX, Wu MC, Wang HY.
Journal:Front Med China. 2010 Dec;4(4):399-411. Epub 2010 Nov 23.
Entrez:21107751

siRNA sequence "gcccaccaggucuugccc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcccaccaggucuugccc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1673 " record
Length: 18
GC Content:72 %
Starting position: 226
Strain of Virus: adr
GenBank Acc: M38454
Transfection Reagent: Lipofectamine 2000

Offtargets for "gcccaccaggucuugccc" siRNA in Human Genome sequences
See M38454 at Genbank
Pubmed:16353167
Article:Knock-down of hepatitis B virus X protein reduces the tumorigenicity of hepatocellular carcinoma cells.
Authors:Chan DW, Ng IO.
Journal:J Pathol. 2006 Feb;208(3):372-80.
Entrez:16353167

siRNA sequence "aaugucaacaaccgaccuuga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaugucaacaaccgaccuuga" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1666 " record
Length: 21
GC Content:43 %
Starting position: 306
Strain of Virus: adw
GenBank Acc: GQ855357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "aaugucaacaaccgaccuuga" siRNA in Human Genome sequences
See GQ855357 at Genbank
Pubmed:17296261
Article:RNA interference targeting HBx suppresses tumor growth and enhances cisplatin chemosensitivity in human hepatocellular carcinoma.
Authors:Cheng AS, Wong N, Tse AM, Chan KY, Chan KK, Sung JJ, Chan HL.
Journal:Cancer Lett. 2007 Aug 8;253(1):43-52. Epub 2007 Feb 12.
Entrez:17296261

siRNA sequence "gaggacucuuggacucuca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaggacucuuggacucuca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1437 " record
Length: 19
GC Content:53 %
Starting position: 1655
Incubation Time (Hours):72

Offtargets for "gaggacucuuggacucuca" siRNA in Human Genome sequences
See at Genbank
Pubmed:16443303
Article:Efficient inhibition of hepatitis B virus replication by small interfering RNAs targeted to the viral X gene in mice.
Authors:Shin D, Kim SI, Kim M, Park M.
Journal:Virus Res. 2006 Aug;119(2):146-53. Epub 2006 Jan 26.
Entrez:16443303

siRNA sequence "cguccgaccuugaggcaua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cguccgaccuugaggcaua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1439 " record
Length: 19
GC Content:58 %
Starting position: 1684
Incubation Time (Hours):72

Offtargets for "cguccgaccuugaggcaua" siRNA in Human Genome sequences
See at Genbank
Pubmed:16443303
Article:Efficient inhibition of hepatitis B virus replication by small interfering RNAs targeted to the viral X gene in mice.
Authors:Shin D, Kim SI, Kim M, Park M.
Journal:Virus Res. 2006 Aug;119(2):146-53. Epub 2006 Jan 26.
Entrez:16443303

siRNA sequence "gaccuugaggcauacuuca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaccuugaggcauacuuca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1465 " record
Length: 19
GC Content:47 %
Starting position: 1694
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "gaccuugaggcauacuuca" siRNA in Human Genome sequences
See at Genbank
Pubmed:14592428
Article:Inhibition of hepatitis B virus replication by stably expressed shRNA.
Authors:Chen Y, Du D, Wu J, Chan CP, Tan Y, Kung HF, He ML.
Journal:Biochem Biophys Res Commun. 2003 Nov 14;311(2):398-404.
Entrez:14592428

siRNA sequence "gcacuucgcuucaccucug" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcacuucgcuucaccucug" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1999 " record
Length: 19
GC Content:58 %
Starting position: 1583
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcacuucgcuucaccucug" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "cgcccaccgaauguugccc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cgcccaccgaauguugccc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1671 " record
Length: 19
GC Content:68 %
Starting position: 1627
Strain of Virus: adw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000

Offtargets for "cgcccaccgaauguugccc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16353167
Article:Knock-down of hepatitis B virus X protein reduces the tumorigenicity of hepatocellular carcinoma cells.
Authors:Chan DW, Ng IO.
Journal:J Pathol. 2006 Feb;208(3):372-80.
Entrez:16353167

siRNA sequence "aaugucaacgaccgaccuuga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaugucaacgaccgaccuuga" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1148 " record
Length: 21
GC Content:48 %
Starting position: 1681
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aaugucaacgaccgaccuuga" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "ugucaacgaccgaccuuga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ugucaacgaccgaccuuga" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1039 " record
Length: 19
GC Content:53 %
Starting position: 1683
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ugucaacgaccgaccuuga" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17596868
Article:Targeted inhibition of HBV gene expression by single-chain antibody mediated small interfering RNA delivery.
Authors:Wen WH, Liu JY, Qin WJ, Zhao J, Wang T, Jia LT, Meng YL, Gao H, Xue CF, Jin BQ, Yao LB, Chen SY, Yang AG.
Journal:Hepatology. 2007 Jul;46(1):84-94.
Entrez:17596868

siRNA sequence "aaggucuuacauaagaggacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaggucuuacauaagaggacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1146 " record
Length: 21
GC Content:38 %
Starting position: 1646
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aaggucuuacauaagaggacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "cuaggaggcuguaggcaua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cuaggaggcuguaggcaua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1127 " record
Length: 19
GC Content:53 %
Starting position: 1774
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cuaggaggcuguaggcaua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "gaccgugugcacuucgcuu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaccgugugcacuucgcuu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1048 " record
Length: 19
GC Content:58 %
Starting position: 203
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gaccgugugcacuucgcuu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "uucaccucugcacgucgca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uucaccucugcacgucgca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1464 " record
Length: 19
GC Content:58 %
Starting position: 1592
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "uucaccucugcacgucgca" siRNA in Human Genome sequences
See at Genbank
Pubmed:14592428
Article:Inhibition of hepatitis B virus replication by stably expressed shRNA.
Authors:Chen Y, Du D, Wu J, Chan CP, Tan Y, Kung HF, He ML.
Journal:Biochem Biophys Res Commun. 2003 Nov 14;311(2):398-404.
Entrez:14592428

siRNA sequence "uucaccucugccuaaucau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uucaccucugccuaaucau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1466 " record
Length: 19
GC Content:42 %
Starting position: 1826
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "uucaccucugccuaaucau" siRNA in Human Genome sequences
See at Genbank
Pubmed:14592428
Article:Inhibition of hepatitis B virus replication by stably expressed shRNA.
Authors:Chen Y, Du D, Wu J, Chan CP, Tan Y, Kung HF, He ML.
Journal:Biochem Biophys Res Commun. 2003 Nov 14;311(2):398-404.
Entrez:14592428

siRNA sequence "aaggucuuacauaagaggacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaggucuuacauaagaggacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1124 " record
Length: 21
GC Content:38 %
Starting position: 1646
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aaggucuuacauaagaggacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "aagaggacucuuggacucucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaggacucuuggacucucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1147 " record
Length: 21
GC Content:48 %
Starting position: 1658
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "aagaggacucuuggacucucu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17334648
Article:Effective inhibition of hepatitis B virus replication by small interfering RNAs expressed from human foamy virus vectors.
Authors:Sun Y, Li Z, Li L, Li J, Liu X, Li W.
Journal:Int J Mol Med. 2007 Apr;19(4):705-11.
Entrez:17334648

siRNA sequence "ccgugaacgcccaccgaau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccgugaacgcccaccgaau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1052 " record
Length: 19
GC Content:63 %
Starting position: 248
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ccgugaacgcccaccgaau" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "gggaggagauuagauuaaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gggaggagauuagauuaaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1056 " record
Length: 19
GC Content:37 %
Starting position: 374
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gggaggagauuagauuaaa" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "cgaccgaccuugaggcaua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cgaccgaccuugaggcaua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1054 " record
Length: 19
GC Content:58 %
Starting position: 317
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cgaccgaccuugaggcaua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553

siRNA sequence "gcaaugucaacgaccgacc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcaaugucaacgaccgacc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1313 " record
Length: 19
GC Content:58 %
Starting position: 1679
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Sofast
Incubation Time (Hours):48

Offtargets for "gcaaugucaacgaccgacc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16022904
Article:Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment.
Authors:Wu KL, Zhang X, Zhang J, Yang Y, Mu YX, Liu M, Lu L, Li Y, Zhu Y, Wu J.
Journal:Virus Res. 2005 Sep;112(1-2):100-7. Epub 2005 Apr 26.
Entrez:16022904

siRNA sequence "auuggucuguucaccagca" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "auuggucuguucaccagca" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1441 " record
Length: 19
GC Content:47 %
Starting position: 1790
Incubation Time (Hours):72

Offtargets for "auuggucuguucaccagca" siRNA in Human Genome sequences
See at Genbank
Pubmed:16443303
Article:Efficient inhibition of hepatitis B virus replication by small interfering RNAs targeted to the viral X gene in mice.
Authors:Shin D, Kim SI, Kim M, Park M.
Journal:Virus Res. 2006 Aug;119(2):146-53. Epub 2006 Jan 26.
Entrez:16443303

siRNA sequence "cccgucugugccuucucau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cccgucugugccuucucau" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1047 " record
Length: 19
GC Content:58 %
Starting position: 178
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cccgucugugccuucucau" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18201553
Article:An accurate quantitative method for screening effective siRNA probes targeting a Hepatitis B virus transcript in single living cells.
Authors:Tong WP, Zhou Y, Wang X, Yang F, Wu KL, Wu J, Zhang Y.
Journal:Biochem Biophys Res Commun. 2008 Mar 21;367(4):866-73. Epub 2008 Jan 15.
Entrez:18201553


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1672	gaggacucuuggacucucu	Hepatitis B Virus [HBV]	X	PLC/PRF/5	RNA	Low	16353167	Blast SL	refseqs
virsi1674	gagcacucuuggacucuca	Hepatitis B Virus [HBV]	X	HepG2.2.15	RNA	Low	16353167	Blast SL	refseqs
virsi1963	cgaccuugaggcauacuuc	Hepatitis B Virus [HBV]	X	HepG2	Protein	Low	21107751	Blast SL	refseqs
virsi1673	gcccaccaggucuugccc	Hepatitis B Virus [HBV]	X	HepG2.2.15	RNA	High	16353167	Blast SL	refseqs
virsi1666	aaugucaacaaccgaccuuga	Hepatitis B Virus [HBV]	X	Hep3B	mRNA	98	17296261	Blast SL	refseqs
virsi1437	gaggacucuuggacucuca	Hepatitis B Virus [HBV]	X	Huh-7	Protein	96	16443303	Blast SL	refseqs
virsi1439	cguccgaccuugaggcaua	Hepatitis B Virus [HBV]	X	Huh-7	Protein	94	16443303	Blast SL	refseqs
virsi1465	gaccuugaggcauacuuca	Hepatitis B Virus [HBV]	X	HepG2	RNA	92	14592428	Blast SL	refseqs
virsi1999	gcacuucgcuucaccucug	Hepatitis B Virus [HBV]	X	HepG2.2.15	DNA	89	16022904	Blast SL	refseqs
virsi1671	cgcccaccgaauguugccc	Hepatitis B Virus [HBV]	X	PLC/PRF/5	RNA	88	16353167	Blast SL	refseqs
virsi1148	aaugucaacgaccgaccuuga	Hepatitis B Virus [HBV]	X	HepG2	RNA	86	17334648	Blast SL	refseqs
virsi1039	ugucaacgaccgaccuuga	Hepatitis B Virus [HBV]	X	HepG2.2.15	Protein	84	17596868	Blast SL	refseqs
virsi1146	aaggucuuacauaagaggacu	Hepatitis B Virus [HBV]	X	HepG2	Protein	84	17334648	Blast SL	refseqs
virsi1127	cuaggaggcuguaggcaua	Hepatitis B Virus [HBV]	X	HepG2.2.15	Protein	82	19026173	Blast SL	refseqs
virsi1048	gaccgugugcacuucgcuu	Hepatitis B Virus [HBV]	X	LinX	Protein	82	18201553	Blast SL	refseqs
virsi1464	uucaccucugcacgucgca	Hepatitis B Virus [HBV]	X	HepG2	RNA	80	14592428	Blast SL	refseqs
virsi1466	uucaccucugccuaaucau	Hepatitis B Virus [HBV]	X	HepG2	RNA	80	14592428	Blast SL	refseqs
virsi1124	aaggucuuacauaagaggacu	Hepatitis B Virus [HBV]	X	HepG2.2.15	Protein	79	19026173	Blast SL	refseqs
virsi1147	aagaggacucuuggacucucu	Hepatitis B Virus [HBV]	X	HepG2	RNA	79	17334648	Blast SL	refseqs
virsi1052	ccgugaacgcccaccgaau	Hepatitis B Virus [HBV]	X	LinX	Protein	78	18201553	Blast SL	refseqs
virsi1056	gggaggagauuagauuaaa	Hepatitis B Virus [HBV]	X	LinX	Protein	78	18201553	Blast SL	refseqs
virsi1054	cgaccgaccuugaggcaua	Hepatitis B Virus [HBV]	X	LinX	Protein	77	18201553	Blast SL	refseqs
virsi1313	gcaaugucaacgaccgacc	Hepatitis B Virus [HBV]	X	BEL-7402	Protein	77	16022904	Blast SL	refseqs
virsi1441	auuggucuguucaccagca	Hepatitis B Virus [HBV]	X	Huh-7	Protein	75	16443303	Blast SL	refseqs
virsi1047	cccgucugugccuucucau	Hepatitis B Virus [HBV]	X	LinX	Protein	75	18201553	Blast SL	refseqs



« previous12next »

: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm