VIRsiRNAdb

Browse BY

Family of Virus

Virus Name

Gene Name

Pubmed Id

VsiRNAid

Total number of Results for

Herpes Simplex Virus [HSV]

Results from

0 - 25

« previous12 next »

siRNA sequence "gaauguaacucgaucugcu" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1909 " record
Length: 19
GC Content:42 %
Starting position: 60467
Strain of Virus: 6B
GenBank Acc: AB021506
Transfection Reagent: Oligofectamine

Offtargets for "gaauguaacucgaucugcu" siRNA in Human Genome sequences

See AB021506 at Genbank

Pubmed:15469723
Article:Inhibition of herpesvirus-6B RNA replication by short interference RNAs.
Authors:Yoon JS, Kim SH, Shin MC, Hong SK, Jung YT, Khang IG, Shin WS, Kim CC, Paik SY.
Journal:J Biochem Mol Biol. 2004 May 31;37(3):383-5.
Entrez:15469723

siRNA sequence "uguuuacgauucgaucga" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1910 " record
Length: 18
GC Content:39 %
Starting position: 60244
Strain of Virus: 6B
GenBank Acc: AB021506
Transfection Reagent: Oligofectamine

Offtargets for "uguuuacgauucgaucga" siRNA in Human Genome sequences

See AB021506 at Genbank

siRNA sequence "gaauacgcuguguuuacau" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1912 " record
Length: 19
GC Content:37 %
Starting position: 83777
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48

Offtargets for "gaauacgcuguguuuacau" siRNA in Human Genome sequences

See AB021506 at Genbank

Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767

siRNA sequence "auagcgcaucugccgaaag" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1913 " record
Length: 19
GC Content:53 %
Starting position: 84287
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48

Offtargets for "auagcgcaucugccgaaag" siRNA in Human Genome sequences

See AB021506 at Genbank

siRNA sequence "uuggaauugauugcgaaag" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1907 " record
Length: 19
GC Content:37 %
Starting position: 60324
Strain of Virus: HSV-2
GenBank Acc: NC_001798
Transfection Reagent: siQUEST
Incubation Time (Hours):24

Offtargets for "uuggaauugauugcgaaag" siRNA in Human Genome sequences

See NC_001798 at Genbank

Pubmed:19154990
Article:Durable protection from Herpes Simplex Virus-2 transmission following intravaginal application of siRNAs targeting both a viral and host gene.
Authors:Wu Y, Navarro F, Lal A, Basar E, Pandey RK, Manoharan M, Feng Y, Lee SJ, Lieberman J, Palliser D.
Journal:Cell Host Microbe. 2009 Jan 22;5(1):84-94.
Entrez:19154990

siRNA sequence "ggacggagauuacacaguuua" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1889 " record
Length: 21
GC Content:43 %
Starting position: 139052
Strain of Virus: HSV-1 Strain 17
GenBank Acc: NC_001806
Transfection Reagent: Lipofectin
Incubation Time (Hours):48

Offtargets for "ggacggagauuacacaguuua" siRNA in Human Genome sequences

See NC_001806 at Genbank

Pubmed:18664330
Article:Short hairpin RNA-mediated inhibition of HSV-1 gene expression and function during HSV-1 infection in Vero cells.
Authors:Liu YY, Deng HY, Yang G, Jiang WL, Grossin L, Yang ZQ.
Journal:Acta Pharmacol Sin. 2008 Aug;29(8):975-82.
Entrez:18664330

siRNA sequence "ggaacuacuaugacagcuuca" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1888 " record
Length: 21
GC Content:43 %
Starting position: 138897
Strain of Virus: HSV-1 Strain 17
GenBank Acc: NC_001806
Transfection Reagent: Lipofectin
Incubation Time (Hours):48

Offtargets for "ggaacuacuaugacagcuuca" siRNA in Human Genome sequences

See NC_001806 at Genbank

siRNA sequence "uugccuucgaccuuuacgu" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1917 " record
Length: 19
GC Content:47 %
Starting position: 132182
Strain of Virus: HHV-8
GenBank Acc: AF148805
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "uugccuucgaccuuuacgu" siRNA in Human Genome sequences

See AF148805 at Genbank

Pubmed:19129458
Article:A systems biology approach to identify the combination effects of human herpesvirus 8 genes on NF-kappaB activation.
Authors:Konrad A, Wies E, Thurau M, Marquardt G, Naschberger E, Hentschel S, Jochmann R, Schulz TF, Erfle H, Brors B, Lausen B, Neipel F, Strzl M.
Journal:J Virol. 2009 Mar;83(6):2563-74. Epub 2009 Jan 7.
Entrez:19129458

siRNA sequence "atcggtgtgtatgctaaag" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1915 " record
Length: 19
GC Content:42 %
Starting position: 1390
Strain of Virus: HHV-6
GenBank Acc: Z18287
Incubation Time (Hours):48

Offtargets for "atcggtgtgtatgctaaag" siRNA in Human Genome sequences

See Z18287 at Genbank

siRNA sequence "gtgaaacgatgtgttataa" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1916 " record
Length: 19
GC Content:32 %
Starting position: 2087
Strain of Virus: HHV-6
GenBank Acc: Z18287
Incubation Time (Hours):48

Offtargets for "gtgaaacgatgtgttataa" siRNA in Human Genome sequences

See Z18287 at Genbank

siRNA sequence "uuaauagacaaugaccaca" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1898 " record
Length: 19
GC Content:32 %
Starting position: 12604
Strain of Virus: HSV-2
GenBank Acc: NC_001798
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):24

Offtargets for "uuaauagacaaugaccaca" siRNA in Human Genome sequences

See NC_001798 at Genbank

Pubmed:16306938
Article:An siRNA-based microbicide protects mice from lethal herpes simplex virus 2 infection.
Authors:Palliser D, Chowdhury D, Wang QY, Lee SJ, Bronson RT, Knipe DM, Lieberman J.
Journal:Nature. 2006 Jan 5;439(7072):89-94. Epub 2005 Nov 23.
Entrez:16306938

siRNA sequence "aucaacaccauaaaguacc" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1891 " record
Length: 19
GC Content:37 %
Starting position: 1838
Strain of Virus: HSV-1
GenBank Acc: K03350
Transfection Reagent: Lipofectin
Incubation Time (Hours):48

Offtargets for "aucaacaccauaaaguacc" siRNA in Human Genome sequences

See K03350 at Genbank

Pubmed:17979991
Article:Inhibition of herpes simplex virus type 1 by small interfering RNA.
Authors:Zhang YQ, Lai W, Li H, Li G.
Journal:Clin Exp Dermatol. 2008 Jan;33(1):56-61. Epub 2007 Nov 2.
Entrez:17979991

siRNA sequence "uuggaauugauugcgaaag" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1902 " record
Length: 19
GC Content:37 %
Starting position: 60324
Strain of Virus: HSV-2
GenBank Acc: NC_001798
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):24

Offtargets for "uuggaauugauugcgaaag" siRNA in Human Genome sequences

See NC_001798 at Genbank

siRNA sequence "gucggucgagaauacgcugug" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1911 " record
Length: 21
GC Content:57 %
Starting position: 83768
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48

Offtargets for "gucggucgagaauacgcugug" siRNA in Human Genome sequences

See AB021506 at Genbank

siRNA sequence "guaucuggcuggucaauuu" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1914 " record
Length: 19
GC Content:42 %
Starting position: 84453
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48

Offtargets for "guaucuggcuggucaauuu" siRNA in Human Genome sequences

See AB021506 at Genbank

siRNA sequence "guguggguugagguaugaacacg" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1918 " record
Length: 23
GC Content:52 %
Starting position: 122857
Strain of Virus: HHV-8
GenBank Acc: AF148805
Incubation Time (Hours):72

Offtargets for "guguggguugagguaugaacacg" siRNA in Human Genome sequences

See AF148805 at Genbank

Pubmed:15190178
Article:Activation of alternative NF-kappa B pathway by human herpes virus 8-encoded Fas-associated death domain-like IL-1 beta-converting enzyme inhibitory protein (vFLIP).
Authors:Matta H, Chaudhary PM.
Journal:Proc Natl Acad Sci U S A. 2004 Jun 22;101(25):9399-404. Epub 2004 Jun 9.
Entrez:15190178

siRNA sequence "aucggcccugaaguaugag" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1904 " record
Length: 19
GC Content:53 %
Starting position: 87928
Strain of Virus: HSV-1 (F)
GenBank Acc: X14112
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aucggcccugaaguaugag" siRNA in Human Genome sequences

See X14112 at Genbank

Pubmed:18551244
Article:Effect of siRNA on HSV-1 plaque formation and relative expression levels of UL39 mRNA.
Authors:Zhe R, Mei-Ying Z, Kitazato K, Kobayash N, Qin-Chang Z, Pei-Zhuo Z, Zhi-Rong Y, Yi-Fei W.
Journal:Arch Virol. 2008;153(7):1401-6. Epub 2008 Jun 13.
Entrez:18551244

siRNA sequence "gaguucugcacgaucacgu" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1900 " record
Length: 19
GC Content:53 %
Starting position: 54370
Strain of Virus: HSV-2
GenBank Acc: NC_001798
Transfection Reagent: TransIT-TKO
Incubation Time (Hours):24

Offtargets for "gaguucugcacgaucacgu" siRNA in Human Genome sequences

See NC_001798 at Genbank

siRNA sequence "aauauacgaaucgugucugua" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1908 " record
Length: 21
GC Content:33 %
Starting position: 155351
Strain of Virus: HSV-1 Strain 17
GenBank Acc: FJ593289
Transfection Reagent: Lipofectin
Incubation Time (Hours):72

Offtargets for "aauauacgaaucgugucugua" siRNA in Human Genome sequences

See FJ593289 at Genbank

Pubmed:15367593
Article:Short interfering RNA-mediated inhibition of herpes simplex virus type 1 gene expression and function during infection of human keratinocytes.
Authors:Bhuyan PK, KarikÃ² K, Capodici J, Lubinski J, Hook LM, Friedman HM, Weissman D.
Journal:J Virol. 2004 Oct;78(19):10276-81.
Entrez:15367593

siRNA sequence "cugcaccaugaucaucgac" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1903 " record
Length: 19
GC Content:53 %
Starting position: 86677
Strain of Virus: HSV-1 (F)
GenBank Acc: X14112
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cugcaccaugaucaucgac" siRNA in Human Genome sequences

See X14112 at Genbank

siRNA sequence "gguacaacaucaucaacuu" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1892 " record
Length: 19
GC Content:37 %
Starting position: 1391
Strain of Virus: HSV-1
GenBank Acc: AX358316
Transfection Reagent: Lipofectin
Incubation Time (Hours):48

Offtargets for "gguacaacaucaucaacuu" siRNA in Human Genome sequences

See AX358316 at Genbank

siRNA sequence "ccauagccaauccaugacc" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1906 " record
Length: 19
GC Content:53 %
Starting position: 89659
Strain of Virus: HSV-1 (F)
GenBank Acc: X14112
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ccauagccaauccaugacc" siRNA in Human Genome sequences

See X14112 at Genbank

siRNA sequence "ggaauuguguacuggaugcgc" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1890 " record
Length: 21
GC Content:52 %
Starting position: 139534
Strain of Virus: HSV-1 Strain 17
GenBank Acc: NC_001806
Transfection Reagent: Lipofectin
Incubation Time (Hours):48

Offtargets for "ggaauuguguacuggaugcgc" siRNA in Human Genome sequences

See NC_001806 at Genbank

siRNA sequence "gcgcugcgacaauaucuuc" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi1905 " record
Length: 19
GC Content:53 %
Starting position: 88486
Strain of Virus: HSV-1 (F)
GenBank Acc: X14112
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcgcugcgacaauaucuuc" siRNA in Human Genome sequences

See X14112 at Genbank

siRNA sequence "ccgacaaacacaccaauuu" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences

Sorry unable to load image

Browse all the records for "Herpes Simplex Virus [HSV]" virus

Browse "virsi2351 " record
Length: 19
GC Content:42 %
Strain of Virus: HSV-1(F)
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "ccgacaaacacaccaauuu" siRNA in Human Genome sequences

See at Genbank

Pubmed:21331889
Article:Effect of siRNAs on HSV-1 plaque formation and relative expression levels of RR mRNA. Ren Z, Li S, Wang QL, Xiang YF, Cui YX, Wang YF, Qi RB, Lu DX, Zhang SM, Zhang PZ. Virol Sin. 2011 Feb;26(1):40-6. Epub 2011 Feb 18. Virol Sin. 2011
Authors:21331889
Journal:
Entrez:

VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With
virsi1909	gaauguaacucgaucugcu	Herpes Simplex Virus [HSV]	UL38	SupT1	Protein	Medium	15469723	Blast SL	refseqs
virsi1910	uguuuacgauucgaucga	Herpes Simplex Virus [HSV]	UL38	SupT1	Protein	Medium	15469723	Blast SL	refseqs
virsi1912	gaauacgcuguguuuacau	Herpes Simplex Virus [HSV]	U51	SupT1	Protein	Medium	16140767	Blast SL	refseqs
virsi1913	auagcgcaucugccgaaag	Herpes Simplex Virus [HSV]	U51	SupT1	Protein	Medium	16140767	Blast SL	refseqs
virsi1907	uuggaauugauugcgaaag	Herpes Simplex Virus [HSV]	UL29	NIH 3T3	Plaque Count	High	19154990	Blast SL	refseqs
virsi1889	ggacggagauuacacaguuua	Herpes Simplex Virus [HSV]	gD	Vero, Strain 186	Viral Load	97	18664330	Blast SL	refseqs
virsi1888	ggaacuacuaugacagcuuca	Herpes Simplex Virus [HSV]	gD	Vero, Strain 186	Viral Load	96	18664330	Blast SL	refseqs
virsi1917	uugccuucgaccuuuacgu	Herpes Simplex Virus [HSV]	ORF75	HEK 293T	mRNA	95	19129458	Blast SL	refseqs
virsi1915	atcggtgtgtatgctaaag	Herpes Simplex Virus [HSV]	gB	SupT1	Protein	90	16140767	Blast SL	refseqs
virsi1916	gtgaaacgatgtgttataa	Herpes Simplex Virus [HSV]	gB	SupT1	Protein	90	16140767	Blast SL	refseqs
virsi1898	uuaauagacaaugaccaca	Herpes Simplex Virus [HSV]	UL5	Vero	mRNA	88	16306938	Blast SL	refseqs
virsi1891	aucaacaccauaaaguacc	Herpes Simplex Virus [HSV]	Vp 16	Vero	Cell Count	85	17979991	Blast SL	refseqs
virsi1902	uuggaauugauugcgaaag	Herpes Simplex Virus [HSV]	UL29	Vero	mRNA	82	16306938	Blast SL	refseqs
virsi1911	gucggucgagaauacgcugug	Herpes Simplex Virus [HSV]	U51	SupT1	Protein	80	16140767	Blast SL	refseqs
virsi1914	guaucuggcuggucaauuu	Herpes Simplex Virus [HSV]	U51	SupT1	Protein	80	16140767	Blast SL	refseqs
virsi1918	guguggguugagguaugaacacg	Herpes Simplex Virus [HSV]	K13	BC-3	Protein	80	15190178	Blast SL	refseqs
virsi1904	aucggcccugaaguaugag	Herpes Simplex Virus [HSV]	UL39	Vero	Protein	80	18551244	Blast SL	refseqs
virsi1900	gaguucugcacgaucacgu	Herpes Simplex Virus [HSV]	UL27	Vero	mRNA	75	16306938	Blast SL	refseqs
virsi1908	aauauacgaaucgugucugua	Herpes Simplex Virus [HSV]	gE	HaCaT	Plaque Count	75	15367593	Blast SL	refseqs
virsi1903	cugcaccaugaucaucgac	Herpes Simplex Virus [HSV]	UL39	Vero	Protein	71	18551244	Blast SL	refseqs
virsi1892	gguacaacaucaucaacuu	Herpes Simplex Virus [HSV]	DNA Pol	Vero	Cell Count	70	17979991	Blast SL	refseqs
virsi1906	ccauagccaauccaugacc	Herpes Simplex Virus [HSV]	UL39	Vero	Protein	69	18551244	Blast SL	refseqs
virsi1890	ggaauuguguacuggaugcgc	Herpes Simplex Virus [HSV]	gD	Vero, Strain 186	Viral Load	66	18664330	Blast SL	refseqs
virsi1905	gcgcugcgacaauaucuuc	Herpes Simplex Virus [HSV]	UL39	Vero	Protein	65	18551244	Blast SL	refseqs
virsi2351	ccgacaaacacaccaauuu	Herpes Simplex Virus [HSV]	UL40	Vero	Plaque Count	63	21331889	Blast SL	refseqs

« previous12 next »

: siRNA seedlocator algorithm

VIRsiRNAdb

Database of Viral siRNA / shRNA

Browse BY