VIRsiRNAid | siRNA Sequence | Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
virsi1999 | gcacuucgcuucaccucug | Hepatitis B Virus [HBV] | X | HepG2.2.15 | DNA | 89 | 16022904 | Blast SL | refseqs |       |
virsi1161 | aagaccuagucaguuaug | Hepatitis B Virus [HBV] | C | HepAD38 | DNA | 85 | 12951075 | Blast SL | refseqs |       |
virsi1996 | gcucccgcgugucuuggcc | Hepatitis B Virus [HBV] | S | HepG2.2.15 | DNA | 83 | 16022904 | Blast SL | refseqs |       |
virsi2010 | aagaccuagucaguuaug | Hepatitis B Virus [HBV] | C | HepAD79 | DNA | 82 | 12951075 | Blast SL | refseqs |       |
virsi2011 | gguggacuucucucaauuu | Hepatitis B Virus [HBV] | S | HepG2.2.15 | DNA | 78 | 16022904 | Blast SL | refseqs |       |
virsi1953 | gaugugucugcggcguuuuau | Hepatitis B Virus [HBV] | S | Huh-7 | mRNA | High | 20696079 | Blast SL | refseqs |       | Pubmed:
20696079 Article:
RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.Authors:
Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.Journal:
BMC Microbiol. 2010 Aug 10;10:214.Entrez:
20696079
virsi1951 | uccuacuguucaagccuccaa | Hepatitis B Virus [HBV] | C | HepG2 2.2.15 | mRNA | High | 20622325 | Blast SL | refseqs |       |
virsi1666 | aaugucaacaaccgaccuuga | Hepatitis B Virus [HBV] | X | Hep3B | mRNA | 98 | 17296261 | Blast SL | refseqs |       |
virsi1955 | aggcuguaggcauaaauuggu | Hepatitis B Virus [HBV] | S | Huh-7 | mRNA | 88 | 20696079 | Blast SL | refseqs |       | Pubmed:
20696079 Article:
RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.Authors:
Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.Journal:
BMC Microbiol. 2010 Aug 10;10:214.Entrez:
20696079
virsi1023 | gguauguugcccguuuguc | Hepatitis B Virus [HBV] | S | HepG2.2.15 | mRNA | 85 | 18274934 | Blast SL | refseqs |       |
virsi1952 | agucuagacucgugguggacu | Hepatitis B Virus [HBV] | S | Huh-7 | mRNA | 81 | 20696079 | Blast SL | refseqs |       | Pubmed:
20696079 Article:
RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.Authors:
Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.Journal:
BMC Microbiol. 2010 Aug 10;10:214.Entrez:
20696079
virsi1954 | gcacuucgcuucaccucugca | Hepatitis B Virus [HBV] | S | Huh-7 | mRNA | 79 | 20696079 | Blast SL | refseqs |       | Pubmed:
20696079 Article:
RNA Interference inhibits hepatitis B virus of different genotypes in vitro and in vivo.Authors:
Zhang YL, Cheng T, Cai YJ, Yuan Q, Liu C, Zhang T, Xia DZ, Li RY, Yang LW, Wang YB, Yeo AE, Shih JW, Zhang J, Xia NS.Journal:
BMC Microbiol. 2010 Aug 10;10:214.Entrez:
20696079
virsi1157 | ccuccaaucacucaccaac | Hepatitis B Virus [HBV] | S | HepG2.2.15 | mRNA | 75 | 15316660 | Blast SL | refseqs |       |
virsi1020 | gugguggacuucucucaau | Hepatitis B Virus [HBV] | S | HepG2.2.15 | mRNA | 72 | 18274934 | Blast SL | refseqs |       |
virsi1021 | aaccuccaaucacucaccaac | Hepatitis B Virus [HBV] | S | HepG2.2.15 | mRNA | 59 | 18274934 | Blast SL | refseqs |       |
virsi1156 | gguauguugcccguuuguc | Hepatitis B Virus [HBV] | S | HepG2.2.15 | mRNA | 55 | 15316660 | Blast SL | refseqs |       |
virsi1022 | gccucaucuucuuguuggu | Hepatitis B Virus [HBV] | S | HepG2.2.15 | mRNA | 54 | 18274934 | Blast SL | refseqs |       |
virsi1964 | acauaagaggacucuugga | Hepatitis B Virus [HBV] | X | PLC/PRF/5 | mRNA | 52 | 20538734 | Blast SL | refseqs |       | Pubmed:
20538734 Article:
Effects of the TP53 p.R249S mutant on proliferation and clonogenic properties in human hepatocellular carcinoma cell lines: interaction with hepatitis B virus X protein.Authors:
Gouas DA, Shi H, Hautefeuille AH, Ortiz-Cuaran SL, Legros PC, Szymanska KJ, Galy O, Egevad LA, Abedi-Ardekani B, Wiman KG, Hantz O, Caron de Fromentel C, Chemin IA, Hainaut PL.Journal:
Carcinogenesis. 2010 Aug;31(8):1475-82. Epub 2010 Jun 10.Entrez:
20538734
virsi2283 | cuaccgugugucuuggcca | Hepatitis B Virus [HBV] | ORF-S | HepG2.2.15 | Protein | Medium | 17926641 | Blast SL | refseqs |       | Pubmed:
17926641 Article:
The short hairpin RNA driven by polymerase II suppresses both wild-type and lamivudine-resistant hepatitis B virus strains.Authors:
Ren GL, Fang Y, Ma HH, Lei YF, Wang D, Xu MC, Wang PZ, Huang CX, Nie OH, Sun YT, Bai XF.Journal:
Antivir Ther. 2007;12(6):865-76.Entrez:
17926641
virsi2284 | gauccagcaucuagagacc | Hepatitis B Virus [HBV] | ORF-C | HepG2.2.15 | Protein | Medium | 17926641 | Blast SL | refseqs |       | Pubmed:
17926641 Article:
The short hairpin RNA driven by polymerase II suppresses both wild-type and lamivudine-resistant hepatitis B virus strains.Authors:
Ren GL, Fang Y, Ma HH, Lei YF, Wang D, Xu MC, Wang PZ, Huang CX, Nie OH, Sun YT, Bai XF.Journal:
Antivir Ther. 2007;12(6):865-76.Entrez:
17926641
virsi1959 | auuccuaugggagugggcc | Hepatitis B Virus [HBV] | S | 293T | Protein | Low | 20642484 | Blast SL | refseqs |       |
virsi1963 | cgaccuugaggcauacuuc | Hepatitis B Virus [HBV] | X | HepG2 | Protein | Low | 21107751 | Blast SL | refseqs |       |
virsi1032 | cgggacguccuuuguuuacgu | Hepatitis B Virus [HBV] | HBeAg | Huh-7 | Protein | Low | 19159285 | Blast SL | refseqs |       | Pubmed:
19159285 Article:
Controlling HBV replication in vivo by intravenous administration of triggered PEGylated siRNA-nanoparticles.Authors:
Carmona S, Jorgensen MR, Kolli S, Crowther C, Salazar FH, Marion PL, Fujino M, Natori Y, Thanou M, Arbuthnot P, Miller AD.Journal:
Mol Pharm. 2009 May-Jun;6(3):706-17.Entrez:
19159285
virsi1034 | ugggggaggagauuagguuaa | Hepatitis B Virus [HBV] | HBeAg | Huh-7 | Protein | Low | 19159285 | Blast SL | refseqs |       | Pubmed:
19159285 Article:
Controlling HBV replication in vivo by intravenous administration of triggered PEGylated siRNA-nanoparticles.Authors:
Carmona S, Jorgensen MR, Kolli S, Crowther C, Salazar FH, Marion PL, Fujino M, Natori Y, Thanou M, Arbuthnot P, Miller AD.Journal:
Mol Pharm. 2009 May-Jun;6(3):706-17.Entrez:
19159285
virsi1035 | agguuaaaggucuuuguauua | Hepatitis B Virus [HBV] | HBeAg | Huh-7 | Protein | Low | 19159285 | Blast SL | refseqs |       | Pubmed:
19159285 Article:
Controlling HBV replication in vivo by intravenous administration of triggered PEGylated siRNA-nanoparticles.Authors:
Carmona S, Jorgensen MR, Kolli S, Crowther C, Salazar FH, Marion PL, Fujino M, Natori Y, Thanou M, Arbuthnot P, Miller AD.Journal:
Mol Pharm. 2009 May-Jun;6(3):706-17.Entrez:
19159285