VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Enterovirus [EV] are 22
Results from 0 - 25

siRNA sequence "auggcugcuuauggugaca" alignment with "Enterovirus [EV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi2343 " record
Length: 19
GC Content:47 %
Strain of Virus: EV70
GenBank Acc: D00820
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):12

Offtargets for "auggcugcuuauggugaca" siRNA in Human Genome sequences
See D00820 at Genbank
Pubmed:20739472
Article:An antiviral small-interfering RNA simultaneously effective against the most prevalent enteroviruses causing acute hemorrhagic conjunctivitis.
Authors: Jun EJ, Won MA, Ahn J, Ko A, Moon H, Tchah H, Kim YK, Lee H. Invest Ophthalmol Vis Sci. 2011 Jan 5;52(1):58-63. Print 2011 Jan. Invest Ophthalmol Vis Sci. 2011 20739472
Journal:
Entrez:

siRNA sequence "uggugaugauguaauugcu" alignment with "Enterovirus [EV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi2347 " record
Length: 19
GC Content:37 %
Strain of Virus: EV70
GenBank Acc: D00820
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):12

Offtargets for "uggugaugauguaauugcu" siRNA in Human Genome sequences
See D00820 at Genbank
Pubmed:20739472
Article:An antiviral small-interfering RNA simultaneously effective against the most prevalent enteroviruses causing acute hemorrhagic conjunctivitis.
Authors: Jun EJ, Won MA, Ahn J, Ko A, Moon H, Tchah H, Kim YK, Lee H. Invest Ophthalmol Vis Sci. 2011 Jan 5;52(1):58-63. Print 2011 Jan. Invest Ophthalmol Vis Sci. 2011 20739472
Journal:
Entrez:

siRNA sequence "gaaauuggcucgaauuguu" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "gaaauuggcucgaauuguu" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1774 " record
Length: 19
GC Content:37 %
Starting position: 7306
Strain of Virus: EV71 (5865/ SIN/00009)
GenBank Acc: AF316321
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "gaaauuggcucgaauuguu" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17712333
Article:Inhibition of enterovirus 71 in virus-infected mice by RNA interference.
Authors:Tan EL, Tan TM, Tak Kwong Chow V, Poh CL.
Journal:Mol Ther. 2007 Nov;15(11):1931-8. Epub 2007 Aug 21.
Entrez:17712333

siRNA sequence "augcgccagcuaaaaccaa" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "augcgccagcuaaaaccaa" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1772 " record
Length: 19
GC Content:47 %
Starting position: 5979
Strain of Virus: EV70 Strain J670/71
GenBank Acc: DQ201177
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48

Offtargets for "augcgccagcuaaaaccaa" siRNA in Human Genome sequences
See DQ201177 at Genbank
Pubmed:18428147
Article:Development of RNA interference (RNAi) as potential antiviral strategy against enterovirus 70.
Authors:Tan EL, Marcus KF, Poh CL.
Journal:J Med Virol. 2008 Jun;80(6):1025-32.
Entrez:18428147

siRNA sequence "gucuagauugauugaagcu" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "gucuagauugauugaagcu" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1770 " record
Length: 19
GC Content:37 %
Starting position: 6442
Strain of Virus: EV70 Strain J670/71
GenBank Acc: DQ201177
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48

Offtargets for "gucuagauugauugaagcu" siRNA in Human Genome sequences
See DQ201177 at Genbank
Pubmed:18428147
Article:Development of RNA interference (RNAi) as potential antiviral strategy against enterovirus 70.
Authors:Tan EL, Marcus KF, Poh CL.
Journal:J Med Virol. 2008 Jun;80(6):1025-32.
Entrez:18428147

siRNA sequence "ccagcgguccugacuagua" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "ccagcgguccugacuagua" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1773 " record
Length: 19
GC Content:58 %
Starting position: 6054
Strain of Virus: EV71
GenBank Acc: U22521
Transfection Reagent: Geneporter

Offtargets for "ccagcgguccugacuagua" siRNA in Human Genome sequences
See U22521 at Genbank
Pubmed:15530419
Article:Selective inhibition of enterovirus 71 replication by short hairpin RNAs.
Authors:Lu WW, Hsu YY, Yang JY, Kung SH.
Journal:Biochem Biophys Res Commun. 2004 Dec 10;325(2):494-9.
Entrez:15530419

siRNA sequence "gcgcaauuaacuauuggcaacucca" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "gcgcaauuaacuauuggcaacucca" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1776 " record
Length: 25
GC Content:44 %
Starting position: 990
Strain of Virus: EV71 Strain Shzh-98
GenBank Acc: AF302996
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcgcaauuaacuauuggcaacucca" siRNA in Human Genome sequences
See AF302996 at Genbank
Pubmed:19490979
Article:Identification of small interfering RNAs which inhibit the replication of several Enterovirus 71 strains in China.
Authors:Wu Z, Yang F, Zhao R, Zhao L, Guo D, Jin Q.
Journal:J Virol Methods. 2009 Aug;159(2):233-8. Epub 2009 Apr 10.
Entrez:19490979

siRNA sequence "uccagcacuccaagcugcugaaauu" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "uccagcacuccaagcugcugaaauu" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1777 " record
Length: 25
GC Content:48 %
Starting position: 2570
Strain of Virus: EV71 Strain Shzh-98
GenBank Acc: AF302996
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "uccagcacuccaagcugcugaaauu" siRNA in Human Genome sequences
See AF302996 at Genbank
Pubmed:19490979
Article:Identification of small interfering RNAs which inhibit the replication of several Enterovirus 71 strains in China.
Authors:Wu Z, Yang F, Zhao R, Zhao L, Guo D, Jin Q.
Journal:J Virol Methods. 2009 Aug;159(2):233-8. Epub 2009 Apr 10.
Entrez:19490979

siRNA sequence "agcuacuuugcgaguaugcaaggugagau" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "agcuacuuugcgaguaugcaaggugagau" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1780 " record
Length: 29
GC Content:45 %
Starting position: 5919
Strain of Virus: EV71 Strain 5865/SIN/00009
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48

Offtargets for "agcuacuuugcgaguaugcaaggugagau" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17316836
Article:Enhanced potency and efficacy of 29-mer shRNAs in inhibition of Enterovirus 71.
Authors:Tan EL, Tan TM, Chow VT, Poh CL.
Journal:Antiviral Res. 2007 Apr;74(1):9-15. Epub 2007 Jan 31.
Entrez:17316836

siRNA sequence "agaaauuggcucgaauuguuuuaauauua" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "agaaauuggcucgaauuguuuuaauauua" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1781 " record
Length: 29
GC Content:24 %
Starting position: 7305
Strain of Virus: EV71 Strain 5865/SIN/00009
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48

Offtargets for "agaaauuggcucgaauuguuuuaauauua" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17316836
Article:Enhanced potency and efficacy of 29-mer shRNAs in inhibition of Enterovirus 71.
Authors:Tan EL, Tan TM, Chow VT, Poh CL.
Journal:Antiviral Res. 2007 Apr;74(1):9-15. Epub 2007 Jan 31.
Entrez:17316836

siRNA sequence "gaaccagaucacgaacuuggagcaguccg" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "gaaccagaucacgaacuuggagcaguccg" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1779 " record
Length: 29
GC Content:55 %
Starting position: 4250
Strain of Virus: EV71 Strain 5865/SIN/00009
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48

Offtargets for "gaaccagaucacgaacuuggagcaguccg" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17316836
Article:Enhanced potency and efficacy of 29-mer shRNAs in inhibition of Enterovirus 71.
Authors:Tan EL, Tan TM, Chow VT, Poh CL.
Journal:Antiviral Res. 2007 Apr;74(1):9-15. Epub 2007 Jan 31.
Entrez:17316836

siRNA sequence "caugucaccugcgagugcuuaucaa" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "caugucaccugcgagugcuuaucaa" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1778 " record
Length: 25
GC Content:48 %
Starting position: 3020
Strain of Virus: EV71 Strain Shzh-98
GenBank Acc: AF302996
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caugucaccugcgagugcuuaucaa" siRNA in Human Genome sequences
See AF302996 at Genbank
Pubmed:19490979
Article:Identification of small interfering RNAs which inhibit the replication of several Enterovirus 71 strains in China.
Authors:Wu Z, Yang F, Zhao R, Zhao L, Guo D, Jin Q.
Journal:J Virol Methods. 2009 Aug;159(2):233-8. Epub 2009 Apr 10.
Entrez:19490979

siRNA sequence "aucggagcuucgucgaaug" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "aucggagcuucgucgaaug" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1771 " record
Length: 19
GC Content:53 %
Starting position: 2592
Strain of Virus: EV71
GenBank Acc: U22521
Transfection Reagent: Geneporter

Offtargets for "aucggagcuucgucgaaug" siRNA in Human Genome sequences
See U22521 at Genbank
Pubmed:15530419
Article:Selective inhibition of enterovirus 71 replication by short hairpin RNAs.
Authors:Lu WW, Hsu YY, Yang JY, Kung SH.
Journal:Biochem Biophys Res Commun. 2004 Dec 10;325(2):494-9.
Entrez:15530419

siRNA sequence "gcuacuuugggaugca" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "gcuacuuugggaugca" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1785 " record
Length: 16
GC Content:50 %
Starting position: 7304
Strain of Virus: EV71 (5865/Sin/000009)
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcuacuuugggaugca" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:16083932
Article:RNA interference against enterovirus 71 infection.
Authors:Sim AC, Luhur A, Tan TM, Chow VT, Poh CL.
Journal:Virology. 2005 Oct 10;341(1):72-9.
Entrez:16083932

siRNA sequence "cuacuuugcgaguaugca" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "cuacuuugcgaguaugca" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1784 " record
Length: 18
GC Content:44 %
Starting position: 5918
Strain of Virus: EV71 (5865/Sin/000009)
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "cuacuuugcgaguaugca" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:16083932
Article:RNA interference against enterovirus 71 infection.
Authors:Sim AC, Luhur A, Tan TM, Chow VT, Poh CL.
Journal:Virology. 2005 Oct 10;341(1):72-9.
Entrez:16083932

siRNA sequence "aaccagaucacgaacuugg" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "aaccagaucacgaacuugg" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1783 " record
Length: 19
GC Content:47 %
Starting position: 4251
Strain of Virus: EV71 (5865/Sin/000009)
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aaccagaucacgaacuugg" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:16083932
Article:RNA interference against enterovirus 71 infection.
Authors:Sim AC, Luhur A, Tan TM, Chow VT, Poh CL.
Journal:Virology. 2005 Oct 10;341(1):72-9.
Entrez:16083932

siRNA sequence "ucuggucguguuaaugacu" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "ucuggucguguuaaugacu" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1782 " record
Length: 19
GC Content:42 %
Starting position: 7361
Strain of Virus: EV71 (5865/Sin/000009)
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "ucuggucguguuaaugacu" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:16083932
Article:RNA interference against enterovirus 71 infection.
Authors:Sim AC, Luhur A, Tan TM, Chow VT, Poh CL.
Journal:Virology. 2005 Oct 10;341(1):72-9.
Entrez:16083932

siRNA sequence "aguccaaaugccguauuga" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "aguccaaaugccguauuga" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1786 " record
Length: 19
GC Content:42 %
Starting position: 4382
Strain of Virus: HEB
GenBank Acc: HM185056
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "aguccaaaugccguauuga" siRNA in Human Genome sequences
See HM185056 at Genbank
Pubmed:17554034
Article:Universal and mutation-resistant anti-enteroviral activity: potency of small interfering RNA complementary to the conserved cis-acting replication element within the enterovirus coding region.
Authors:Lee HS, Ahn J, Jee Y, Seo IS, Jeon EJ, Jeon ES, Joo CH, Kim YK, Lee H.
Journal:J Gen Virol. 2007 Jul;88(Pt 7):2003-12.
Entrez:17554034

siRNA sequence "gcauuugacuacacagguu" alignment with "Enterovirus [EV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi2345 " record
Length: 19
GC Content:42 %
Strain of Virus: EV70
GenBank Acc: D00820
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):12

Offtargets for "gcauuugacuacacagguu" siRNA in Human Genome sequences
See D00820 at Genbank
Pubmed:20739472
Article:An antiviral small-interfering RNA simultaneously effective against the most prevalent enteroviruses causing acute hemorrhagic conjunctivitis.
Authors: Jun EJ, Won MA, Ahn J, Ko A, Moon H, Tchah H, Kim YK, Lee H. Invest Ophthalmol Vis Sci. 2011 Jan 5;52(1):58-63. Print 2011 Jan. Invest Ophthalmol Vis Sci. 2011 20739472
Journal:
Entrez:

siRNA sequence "agaaauuggcucgaauuguuuuaauauua" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "agaaauuggcucgaauuguuuuaauauua" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1775 " record
Length: 29
GC Content:24 %
Starting position: 7305
Strain of Virus: EV71 (5865/ SIN/00009)
GenBank Acc: AF316321
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "agaaauuggcucgaauuguuuuaauauua" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17712333
Article:Inhibition of enterovirus 71 in virus-infected mice by RNA interference.
Authors:Tan EL, Tan TM, Tak Kwong Chow V, Poh CL.
Journal:Mol Ther. 2007 Nov;15(11):1931-8. Epub 2007 Aug 21.
Entrez:17712333

siRNA sequence "ggcugcuuauggugacaau" alignment with "Enterovirus [EV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi2344 " record
Length: 19
GC Content:47 %
Strain of Virus: EV70
GenBank Acc: D00820
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):12

Offtargets for "ggcugcuuauggugacaau" siRNA in Human Genome sequences
See D00820 at Genbank
Pubmed:20739472
Article:An antiviral small-interfering RNA simultaneously effective against the most prevalent enteroviruses causing acute hemorrhagic conjunctivitis.
Authors: Jun EJ, Won MA, Ahn J, Ko A, Moon H, Tchah H, Kim YK, Lee H. Invest Ophthalmol Vis Sci. 2011 Jan 5;52(1):58-63. Print 2011 Jan. Invest Ophthalmol Vis Sci. 2011 20739472
Journal:
Entrez:

siRNA sequence "ugacuacacagguuaugau" alignment with "Enterovirus [EV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi2346 " record
Length: 19
GC Content:37 %
Strain of Virus: EV70
GenBank Acc: D00820
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):12

Offtargets for "ugacuacacagguuaugau" siRNA in Human Genome sequences
See D00820 at Genbank
Pubmed:20739472
Article:An antiviral small-interfering RNA simultaneously effective against the most prevalent enteroviruses causing acute hemorrhagic conjunctivitis.
Authors: Jun EJ, Won MA, Ahn J, Ko A, Moon H, Tchah H, Kim YK, Lee H. Invest Ophthalmol Vis Sci. 2011 Jan 5;52(1):58-63. Print 2011 Jan. Invest Ophthalmol Vis Sci. 2011 20739472
Journal:
Entrez:


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi2343	auggcugcuuauggugaca	Enterovirus [EV]	5'NTR	MRC5	Protein	Low	20739472	Blast SL	refseqs
virsi2347	uggugaugauguaauugcu	Enterovirus [EV]	3D	MRC5	Protein	High	20739472	Blast SL	refseqs
virsi1774	gaaauuggcucgaauuguu	Enterovirus [EV]	3D Pol	RD	mRNA	100	17712333	Blast SL	refseqs
virsi1772	augcgccagcuaaaaccaa	Enterovirus [EV]	3D Pol	RD	mRNA	100	18428147	Blast SL	refseqs
virsi1770	gucuagauugauugaagcu	Enterovirus [EV]	3D Pol	RD	mRNA	97	18428147	Blast SL	refseqs
virsi1773	ccagcgguccugacuagua	Enterovirus [EV]	3D2	HeLa	Protein	95	15530419	Blast SL	refseqs
virsi1776	gcgcaauuaacuauuggcaacucca	Enterovirus [EV]	VP2	RD	mRNA	91	19490979	Blast SL	refseqs
virsi1777	uccagcacuccaagcugcugaaauu	Enterovirus [EV]	VP1	RD	RNA	90	19490979	Blast SL	refseqs
virsi1780	agcuacuuugcgaguaugcaaggugagau	Enterovirus [EV]	3C Pro	RD	Protein	89	17316836	Blast SL	refseqs
virsi1781	agaaauuggcucgaauuguuuuaauauua	Enterovirus [EV]	3D Pol	RD	Protein	89	17316836	Blast SL	refseqs
virsi1779	gaaccagaucacgaacuuggagcaguccg	Enterovirus [EV]	2C	RD	Protein	87	17316836	Blast SL	refseqs
virsi1778	caugucaccugcgagugcuuaucaa	Enterovirus [EV]	VP1	RD	RNA	79	19490979	Blast SL	refseqs
virsi1771	aucggagcuucgucgaaug	Enterovirus [EV]	VP1	HeLa	Protein	78	15530419	Blast SL	refseqs
virsi1785	gcuacuuugggaugca	Enterovirus [EV]	3D Pol	RD	RNA	78	16083932	Blast SL	refseqs
virsi1784	cuacuuugcgaguaugca	Enterovirus [EV]	3C Pro	RD	RNA	76	16083932	Blast SL	refseqs
virsi1783	aaccagaucacgaacuugg	Enterovirus [EV]	2C	RD	RNA	54	16083932	Blast SL	refseqs
virsi1782	ucuggucguguuaaugacu	Enterovirus [EV]	3'UTR	RD	RNA	44	16083932	Blast SL	refseqs
virsi1786	aguccaaaugccguauuga	Enterovirus [EV]	MET-2C	HeLa	Viral Titer	16	17554034	Blast SL	refseqs
virsi2345	gcauuugacuacacagguu	Enterovirus [EV]	3D	MRC5	Protein	15	20739472	Blast SL	refseqs
virsi1775	agaaauuggcucgaauuguuuuaauauua	Enterovirus [EV]	3D Pol	RD	mRNA	0	17712333	Blast SL	refseqs
virsi2344	ggcugcuuauggugacaau	Enterovirus [EV]	5'NTR	MRC5	Protein	0	20739472	Blast SL	refseqs
virsi2346	ugacuacacagguuaugau	Enterovirus [EV]	3D	MRC5	Protein	0	20739472	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm