VIRsiRNAid | siRNA Sequence | Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
virsi2313 | ucgcagaaagaaaaauccaac | Semliki Forest Virus | NSP | U4.4 | Protein | 79 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2314 | cgguuaaaggcaguaggguug | Semliki Forest Virus | NSP | U4.4 | Protein | 79 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2309 | gagggauuccuagugugcaag | Semliki Forest Virus | NSP | U4.4 | Protein | 78 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2316 | guuuauuaacacuguuuugaa | Semliki Forest Virus | NSP | U4.4 | Protein | 75 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2315 | gacucgucuuccacugccagc | Semliki Forest Virus | NSP | U4.4 | Protein | 61 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2319 | ugccgaacguggugggguucc | Semliki Forest Virus | Polyprotein | U4.4 | Protein | 56 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2312 | ucgcuugccauuccgguacuc | Semliki Forest Virus | NSP | U4.4 | Protein | 48 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2311 | uccgggaucaggcaagucugc | Semliki Forest Virus | NSP | U4.4 | Protein | 40 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2320 | aggcguacgucgaucgaucgg | Semliki Forest Virus | Polyprotein | U4.4 | Protein | 38 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2322 | caaaucaaaacgaacccuguc | Semliki Forest Virus | Polyprotein | U4.4 | Protein | 18 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2321 | acgaccuguacgcgaacacgg | Semliki Forest Virus | Polyprotein | U4.4 | Protein | 10 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2310 | ugggcgagggaauacaaggca | Semliki Forest Virus | NSP | U4.4 | Protein | 8 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2317 | uggcgagggacauuaaggcgu | Semliki Forest Virus | Polyprotein | U4.4 | Protein | 6 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029
virsi2318 | cgaggauaacguggauaggcc | Semliki Forest Virus | Polyprotein | U4.4 | Protein | 3 | 21191029 | Blast SL | refseqs |       | Pubmed:
21191029 Article:
Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.Authors:
Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.Journal:
J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.Entrez:
21191029