Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 16496015 are 26
Results from 0 - 25
siRNA sequence "gucucguagaccgugcauca" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gucucguagaccgugcauca" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1165 " record
Length: 20
GC Content:55 %
Starting position: 325
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 20
GC Content:55 %
Starting position: 325
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "gucucguagaccgugcauca" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "ccgggaggucucguagaccgugcauca" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ccgggaggucucguagaccgugcauca" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1173 " record
Length: 27
GC Content:63 %
Starting position: 318
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 27
GC Content:63 %
Starting position: 318
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ccgggaggucucguagaccgugcauca" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "ggucucguagaccgugcau" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggucucguagaccgugcau" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1174 " record
Length: 19
GC Content:58 %
Starting position: 324
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:58 %
Starting position: 324
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ggucucguagaccgugcau" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "cucguagaccgugcauca" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "cucguagaccgugcauca" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1176 " record
Length: 18
GC Content:56 %
Starting position: 327
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 18
GC Content:56 %
Starting position: 327
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cucguagaccgugcauca" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "uucuuggaucaacccgcuca" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "uucuuggaucaacccgcuca" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2003 " record
Length: 20
GC Content:50 %
Starting position: 197
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 20
GC Content:50 %
Starting position: 197
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "uucuuggaucaacccgcuca" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "ugaggaacuacugucuucac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ugaggaacuacugucuucac" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2005 " record
Length: 20
GC Content:45 %
Starting position: 50
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 20
GC Content:45 %
Starting position: 50
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ugaggaacuacugucuucac" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "ucucguagaccgugcauca" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1175 " record
Length: 19
GC Content:53 %
Starting position: 326
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:53 %
Starting position: 326
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ucucguagaccgugcauca" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "cuaaaccccaaagaaaaacc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "cuaaaccccaaagaaaaacc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2002 " record
Length: 20
GC Content:40 %
Starting position: 357
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 20
GC Content:40 %
Starting position: 357
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cuaaaccccaaagaaaaacc" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "gagugucgugcagccuccag" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gagugucgugcagccuccag" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2004 " record
Length: 20
GC Content:65 %
Starting position: 100
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 20
GC Content:65 %
Starting position: 100
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gagugucgugcagccuccag" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "agaaaaaccaaacguaacac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "agaaaaaccaaacguaacac" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1166 " record
Length: 20
GC Content:35 %
Starting position: 368
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 20
GC Content:35 %
Starting position: 368
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "agaaaaaccaaacguaacac" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "acuccaccauagaucacucc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "acuccaccauagaucacucc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1009 " record
Length: 20
GC Content:50 %
Starting position: 26
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 20
GC Content:50 %
Starting position: 26
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "acuccaccauagaucacucc" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "ccccgggaggucucguaga" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ccccgggaggucucguaga" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1171 " record
Length: 19
GC Content:68 %
Starting position: 316
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:68 %
Starting position: 316
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ccccgggaggucucguaga" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "cucguagaccgugcaucau" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "cucguagaccgugcaucau" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1177 " record
Length: 19
GC Content:53 %
Starting position: 327
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:53 %
Starting position: 327
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cucguagaccgugcaucau" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "gcucagcccggguacccuug" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gcucagcccggguacccuug" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2001 " record
Length: 20
GC Content:70 %
Starting position: 572
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 20
GC Content:70 %
Starting position: 572
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gcucagcccggguacccuug" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "aggccuugugguacugccugau" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "aggccuugugguacugccugau" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1164 " record
Length: 22
GC Content:55 %
Starting position: 278
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 22
GC Content:55 %
Starting position: 278
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "aggccuugugguacugccugau" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "agguccgugagccgcaugac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "agguccgugagccgcaugac" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1170 " record
Length: 20
GC Content:65 %
Starting position: 9553
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 20
GC Content:65 %
Starting position: 9553
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "agguccgugagccgcaugac" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "ggaggacggcgugaacuaug" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggaggacggcgugaacuaug" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2000 " record
Length: 20
GC Content:60 %
Starting position: 817
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 20
GC Content:60 %
Starting position: 817
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ggaggacggcgugaacuaug" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "guacauuccgcucgucggcg" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "guacauuccgcucgucggcg" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2006 " record
Length: 20
GC Content:65 %
Starting position: 748
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 20
GC Content:65 %
Starting position: 748
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "guacauuccgcucgucggcg" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "gacccccggcguaggucgcg" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gacccccggcguaggucgcg" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2007 " record
Length: 20
GC Content:80 %
Starting position: 674
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 20
GC Content:80 %
Starting position: 674
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gacccccggcguaggucgcg" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "ggcuccaucuuagcccuaguc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggcuccaucuuagcccuaguc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1167 " record
Length: 21
GC Content:57 %
Starting position: 9517
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 21
GC Content:57 %
Starting position: 9517
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "ggcuccaucuuagcccuaguc" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "ggcuagcugugaaagguccgu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggcuagcugugaaagguccgu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1168 " record
Length: 21
GC Content:57 %
Starting position: 9540
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 21
GC Content:57 %
Starting position: 9540
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "ggcuagcugugaaagguccgu" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "ugagcacaaauccuaaaccc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ugagcacaaauccuaaaccc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2008 " record
Length: 20
GC Content:45 %
Starting position: 345
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 20
GC Content:45 %
Starting position: 345
Strain of Virus: HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ugagcacaaauccuaaaccc" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "gcgagugccccgggagguc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gcgagugccccgggagguc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1169 " record
Length: 19
GC Content:79 %
Starting position: 309
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 19
GC Content:79 %
Starting position: 309
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "gcgagugccccgggagguc" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "gccauaguggucugcggaacc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gccauaguggucugcggaacc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1162 " record
Length: 21
GC Content:62 %
Starting position: 139
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 21
GC Content:62 %
Starting position: 139
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "gccauaguggucugcggaacc" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "cccgggaggucucguagac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "cccgggaggucucguagac" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1172 " record
Length: 19
GC Content:68 %
Starting position: 317
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:68 %
Starting position: 317
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cccgggaggucucguagac" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Virus_Name
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm