Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 19471888 are 22
Results from 0 - 25
siRNA sequence "guaagaccucccuuuacaaccuaag" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "guaagaccucccuuuacaaccuaag" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1873 " record
Length: 25
GC Content:44 %
Starting position: 109487
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:44 %
Starting position: 109487
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "guaagaccucccuuuacaaccuaag" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "gcaucguggucaaggagguuccaac" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "gcaucguggucaaggagguuccaac" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1871 " record
Length: 25
GC Content:56 %
Starting position: 109350
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:56 %
Starting position: 109350
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gcaucguggucaaggagguuccaac" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "cugcaaagggacccacgguggaacagg" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "cugcaaagggacccacgguggaacagg" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1867 " record
Length: 27
GC Content:63 %
Starting position: 108192
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 27
GC Content:63 %
Starting position: 108192
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "cugcaaagggacccacgguggaacagg" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "cgauuaaggaccuuguuaugacaaa" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "cgauuaaggaccuuguuaugacaaa" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1877 " record
Length: 25
GC Content:36 %
Starting position: 109682
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:36 %
Starting position: 109682
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "cgauuaaggaccuuguuaugacaaa" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "ccgggagcgauagagcagggccccg" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ccgggagcgauagagcagggccccg" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1869 " record
Length: 25
GC Content:76 %
Starting position: 109240
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:76 %
Starting position: 109240
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "ccgggagcgauagagcagggccccg" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "gcccgcuccuaccugcaauaucaagg" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "gcccgcuccuaccugcaauaucaagg" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1878 " record
Length: 26
GC Content:58 %
Starting position: 97337
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 26
GC Content:58 %
Starting position: 97337
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gcccgcuccuaccugcaauaucaagg" siRNA in Human Genome sequences
See AY961628 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "guaagaccucccuuuacaaccuaag" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "guaagaccucccuuuacaaccuaag" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1874 " record
Length: 25
GC Content:44 %
Starting position: 109487
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:44 %
Starting position: 109487
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "guaagaccucccuuuacaaccuaag" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "gcaucguggucaaggagguuccaac" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "gcaucguggucaaggagguuccaac" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1872 " record
Length: 25
GC Content:56 %
Starting position: 109350
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:56 %
Starting position: 109350
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gcaucguggucaaggagguuccaac" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "gugauaaccauggacgaggacggggaa" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "gugauaaccauggacgaggacggggaa" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1864 " record
Length: 27
GC Content:56 %
Starting position: 108056
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 27
GC Content:56 %
Starting position: 108056
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gugauaaccauggacgaggacggggaa" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "ccuugcuguuccacaaugucguauu" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ccuugcuguuccacaaugucguauu" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1875 " record
Length: 25
GC Content:44 %
Starting position: 97154
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:44 %
Starting position: 97154
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "ccuugcuguuccacaaugucguauu" siRNA in Human Genome sequences
See AY961628 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "gauggaguagauuugccucccuggu" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "gauggaguagauuugccucccuggu" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1880 " record
Length: 25
GC Content:52 %
Starting position: 97383
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:52 %
Starting position: 97383
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gauggaguagauuugccucccuggu" siRNA in Human Genome sequences
See AY961628 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "ccgggagcgauagagcagggccccg" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ccgggagcgauagagcagggccccg" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1870 " record
Length: 25
GC Content:76 %
Starting position: 109240
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:76 %
Starting position: 109240
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "ccgggagcgauagagcagggccccg" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "gcccgcuccuaccugcaauaucaagg" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "gcccgcuccuaccugcaauaucaagg" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1879 " record
Length: 26
GC Content:58 %
Starting position: 97337
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 26
GC Content:58 %
Starting position: 97337
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gcccgcuccuaccugcaauaucaagg" siRNA in Human Genome sequences
See AY961628 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "gauggaguagauuugccucccuggu" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "gauggaguagauuugccucccuggu" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1881 " record
Length: 25
GC Content:52 %
Starting position: 97383
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:52 %
Starting position: 97383
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gauggaguagauuugccucccuggu" siRNA in Human Genome sequences
See AY961628 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "ccuugcuguuccacaaugucguauu" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ccuugcuguuccacaaugucguauu" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1876 " record
Length: 25
GC Content:44 %
Starting position: 97154
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:44 %
Starting position: 97154
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "ccuugcuguuccacaaugucguauu" siRNA in Human Genome sequences
See AY961628 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "cuggaccagaaggcuccggcgg" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "cuggaccagaaggcuccggcgg" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1861 " record
Length: 22
GC Content:73 %
Starting position: 108011
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 22
GC Content:73 %
Starting position: 108011
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "cuggaccagaaggcuccggcgg" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "gugauaaccauggacgaggacggggaa" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "gugauaaccauggacgaggacggggaa" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1863 " record
Length: 27
GC Content:56 %
Starting position: 108056
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 27
GC Content:56 %
Starting position: 108056
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gugauaaccauggacgaggacggggaa" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "aagacauagagaugguguccggagac" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "aagacauagagaugguguccggagac" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1865 " record
Length: 26
GC Content:50 %
Starting position: 108141
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 26
GC Content:50 %
Starting position: 108141
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "aagacauagagaugguguccggagac" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "gcagcuuugacgauggaguagauuu" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "gcagcuuugacgauggaguagauuu" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1882 " record
Length: 25
GC Content:44 %
Starting position: 97372
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 25
GC Content:44 %
Starting position: 97372
Strain of Virus: gD1
GenBank Acc: AY961628
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gcagcuuugacgauggaguagauuu" siRNA in Human Genome sequences
See AY961628 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "cuggaccagaaggcuccggcgg" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "cuggaccagaaggcuccggcgg" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1862 " record
Length: 22
GC Content:73 %
Starting position: 108011
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 22
GC Content:73 %
Starting position: 108011
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "cuggaccagaaggcuccggcgg" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "aagacauagagaugguguccggagac" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "aagacauagagaugguguccggagac" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1866 " record
Length: 26
GC Content:50 %
Starting position: 108141
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 26
GC Content:50 %
Starting position: 108141
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "aagacauagagaugguguccggagac" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
siRNA sequence "cugcaaagggacccacgguggaacagg" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "cugcaaagggacccacgguggaacagg" Epstein-Barr Virus [EBV]" Virus reference Genome sequences

Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1868 " record
Length: 27
GC Content:63 %
Starting position: 108192
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 27
GC Content:63 %
Starting position: 108192
Strain of Virus: B95-8
GenBank Acc: V01555
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "cugcaaagggacccacgguggaacagg" siRNA in Human Genome sequences
See V01555 at Genbank
Pubmed:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888
Article:Maintenance of the viral episome is essential for the cell survival of an Epstein-Barr virus positive gastric carcinoma cell line.
Authors:Oh ST, Kim M, Lee SK.
Journal:Arch Pharm Res. 2009 May;32(5):729-36. Epub 2009 May 27.
Entrez:19471888



SL: siRNA seedlocator algorithm