Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 15780182 are 26
Results from 0 - 25
siRNA sequence "agcuuaaacaacuccuggaac" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "agcuuaaacaacuccuggaac" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1392 " record
Length: 21
GC Content:43 %
Starting position: 26429
GenBank Acc: NC_004723
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 26429
GenBank Acc: NC_004723
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "agcuuaaacaacuccuggaac" siRNA in Human Genome sequences
See NC_004723 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "gauaauggaccccaaucaaac" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "gauaauggaccccaaucaaac" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1384 " record
Length: 21
GC Content:43 %
Starting position: 28126
GenBank Acc: NC_004733
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 28126
GenBank Acc: NC_004733
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gauaauggaccccaaucaaac" siRNA in Human Genome sequences
See NC_004733 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "ugaaggaguuccugaucuucu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "ugaaggaguuccugaucuucu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1395 " record
Length: 21
GC Content:43 %
Starting position: 26320
GenBank Acc: NC_004722
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 26320
GenBank Acc: NC_004722
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ugaaggaguuccugaucuucu" siRNA in Human Genome sequences
See NC_004722 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "uugcugcauacaaccgcuacc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "uugcugcauacaaccgcuacc" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1387 " record
Length: 21
GC Content:52 %
Starting position: 26972
GenBank Acc: NC_004731
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:52 %
Starting position: 26972
GenBank Acc: NC_004731
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "uugcugcauacaaccgcuacc" siRNA in Human Genome sequences
See NC_004731 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "aauccuaauaacaaugcugcc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aauccuaauaacaaugcugcc" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1377 " record
Length: 21
GC Content:38 %
Starting position: 28570
GenBank Acc: NC_004740
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:38 %
Starting position: 28570
GenBank Acc: NC_004740
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "aauccuaauaacaaugcugcc" siRNA in Human Genome sequences
See NC_004740 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "uagcuacuucguugcuuccuu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "uagcuacuucguugcuuccuu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1391 " record
Length: 21
GC Content:43 %
Starting position: 26673
GenBank Acc: NC_004726
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 26673
GenBank Acc: NC_004726
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "uagcuacuucguugcuuccuu" siRNA in Human Genome sequences
See NC_004726 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "ucaaggaacaacauugccaaa" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "ucaaggaacaacauugccaaa" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1374 " record
Length: 21
GC Content:38 %
Starting position: 28608
GenBank Acc: NC_004741
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:38 %
Starting position: 28608
GenBank Acc: NC_004741
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ucaaggaacaacauugccaaa" siRNA in Human Genome sequences
See NC_004741 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "aacgguuuacgucuacucgcg" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aacgguuuacgucuacucgcg" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1394 " record
Length: 21
GC Content:52 %
Starting position: 26278
GenBank Acc: NC_004721
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:52 %
Starting position: 26278
GenBank Acc: NC_004721
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "aacgguuuacgucuacucgcg" siRNA in Human Genome sequences
See NC_004721 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "aaggaggaacuuagauucccu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aaggaggaacuuagauucccu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1379 " record
Length: 21
GC Content:43 %
Starting position: 28303
GenBank Acc: NC_004736
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 28303
GenBank Acc: NC_004736
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "aaggaggaacuuagauucccu" siRNA in Human Genome sequences
See NC_004736 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "aauaauacugcgucuugguuc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aauaauacugcgucuugguuc" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1382 " record
Length: 21
GC Content:38 %
Starting position: 28261
GenBank Acc: NC_004735
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:38 %
Starting position: 28261
GenBank Acc: NC_004735
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "aauaauacugcgucuugguuc" siRNA in Human Genome sequences
See NC_004735 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "agagaucacuguggcuacauc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "agagaucacuguggcuacauc" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1385 " record
Length: 21
GC Content:48 %
Starting position: 26892
GenBank Acc: NC_004729
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 26892
GenBank Acc: NC_004729
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "agagaucacuguggcuacauc" siRNA in Human Genome sequences
See NC_004729 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "uauuguaggcuugauguggcu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "uauuguaggcuugauguggcu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1390 " record
Length: 21
GC Content:43 %
Starting position: 26652
GenBank Acc: NC_004725
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 26652
GenBank Acc: NC_004725
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "uauuguaggcuugauguggcu" siRNA in Human Genome sequences
See NC_004725 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "cgucgcagcguguaggcacug" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "cgucgcagcguguaggcacug" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1386 " record
Length: 21
GC Content:67 %
Starting position: 26942
GenBank Acc: NC_004730
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:67 %
Starting position: 26942
GenBank Acc: NC_004730
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cgucgcagcguguaggcacug" siRNA in Human Genome sequences
See NC_004730 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "ccagaccgcucauggaaagug" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "ccagaccgcucauggaaagug" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1388 " record
Length: 21
GC Content:57 %
Starting position: 26783
GenBank Acc: NC_004727
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:57 %
Starting position: 26783
GenBank Acc: NC_004727
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ccagaccgcucauggaaagug" siRNA in Human Genome sequences
See NC_004727 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "aacguacugccacaaaacagu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aacguacugccacaaaacagu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1373 " record
Length: 21
GC Content:43 %
Starting position: 28904
GenBank Acc: NC_004743
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 28904
GenBank Acc: NC_004743
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "aacguacugccacaaaacagu" siRNA in Human Genome sequences
See NC_004743 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "aauacacccaaagaccacauu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aauacacccaaagaccacauu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1376 " record
Length: 21
GC Content:38 %
Starting position: 28540
GenBank Acc: NC_004739
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:38 %
Starting position: 28540
GenBank Acc: NC_004739
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "aauacacccaaagaccacauu" siRNA in Human Genome sequences
See NC_004739 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "aaggccaaaacagcgccgacc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aaggccaaaacagcgccgacc" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1381 " record
Length: 21
GC Content:62 %
Starting position: 28227
GenBank Acc: NC_004734
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:62 %
Starting position: 28227
GenBank Acc: NC_004734
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "aaggccaaaacagcgccgacc" siRNA in Human Genome sequences
See NC_004734 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "ugcugcugucuacagaauuaa" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "ugcugcugucuacagaauuaa" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1393 " record
Length: 21
GC Content:38 %
Starting position: 26595
GenBank Acc: NC_004724
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:38 %
Starting position: 26595
GenBank Acc: NC_004724
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ugcugcugucuacagaauuaa" siRNA in Human Genome sequences
See NC_004724 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "uugcgaauggccggacacucc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "uugcgaauggccggacacucc" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1389 " record
Length: 21
GC Content:62 %
Starting position: 26839
GenBank Acc: NC_004728
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:62 %
Starting position: 26839
GenBank Acc: NC_004728
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "uugcgaauggccggacacucc" siRNA in Human Genome sequences
See NC_004728 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "ugaggcaucuaaaaagccucg" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "ugaggcaucuaaaaagccucg" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1375 " record
Length: 21
GC Content:48 %
Starting position: 28878
GenBank Acc: NC_004742
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 28878
GenBank Acc: NC_004742
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ugaggcaucuaaaaagccucg" siRNA in Human Genome sequences
See NC_004742 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "aacaaagaaggcaucguaugg" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aacaaagaaggcaucguaugg" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1378 " record
Length: 21
GC Content:43 %
Starting position: 28498
GenBank Acc: NC_004738
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 28498
GenBank Acc: NC_004738
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "aacaaagaaggcaucguaugg" siRNA in Human Genome sequences
See NC_004738 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "uuucgugguauucuugcuagu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "uuucgugguauucuugcuagu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1447 " record
Length: 21
GC Content:38 %
Starting position: 26182
GenBank Acc: NC_004719
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:38 %
Starting position: 26182
GenBank Acc: NC_004719
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "uuucgugguauucuugcuagu" siRNA in Human Genome sequences
See NC_004719 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "uuaauaguuaauagcguacuu" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "uuaauaguuaauagcguacuu" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1997 " record
Length: 21
GC Content:24 %
Starting position: 26150
GenBank Acc: NC_004718
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:24 %
Starting position: 26150
GenBank Acc: NC_004718
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "uuaauaguuaauagcguacuu" siRNA in Human Genome sequences
See NC_004718 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "aaacuauaaauuaaauacaga" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aaacuauaaauuaaauacaga" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1383 " record
Length: 21
GC Content:14 %
Starting position: 27000
GenBank Acc: NC_004732
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:14 %
Starting position: 27000
GenBank Acc: NC_004732
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "aaacuauaaauuaaauacaga" siRNA in Human Genome sequences
See NC_004732 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
siRNA sequence "agcaguacgcacacaaucgaa" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "agcaguacgcacacaaucgaa" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1397 " record
Length: 21
GC Content:48 %
Starting position: 26226
GenBank Acc: NC_004720
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 26226
GenBank Acc: NC_004720
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "agcaguacgcacacaaucgaa" siRNA in Human Genome sequences
See NC_004720 at Genbank
Pubmed:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Article:Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.
Authors:Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.
Journal:Cell Res. 2005 Mar;15(3):193-200.
Entrez:15780182
Virus_Name
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm